ID: 909625993

View in Genome Browser
Species Human (GRCh38)
Location 1:77716633-77716655
Sequence GGTTAGTCTTAGGACCACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 2, 2: 1, 3: 8, 4: 68}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909625985_909625993 13 Left 909625985 1:77716597-77716619 CCCAGTAGAAAGCAATTAAGAAC 0: 1
1: 22
2: 7
3: 57
4: 243
Right 909625993 1:77716633-77716655 GGTTAGTCTTAGGACCACATGGG 0: 1
1: 2
2: 1
3: 8
4: 68
909625984_909625993 14 Left 909625984 1:77716596-77716618 CCCCAGTAGAAAGCAATTAAGAA 0: 1
1: 3
2: 32
3: 52
4: 447
Right 909625993 1:77716633-77716655 GGTTAGTCTTAGGACCACATGGG 0: 1
1: 2
2: 1
3: 8
4: 68
909625989_909625993 -9 Left 909625989 1:77716619-77716641 CCCGGTAAATCAAAGGTTAGTCT 0: 1
1: 1
2: 4
3: 13
4: 116
Right 909625993 1:77716633-77716655 GGTTAGTCTTAGGACCACATGGG 0: 1
1: 2
2: 1
3: 8
4: 68
909625983_909625993 17 Left 909625983 1:77716593-77716615 CCTCCCCAGTAGAAAGCAATTAA No data
Right 909625993 1:77716633-77716655 GGTTAGTCTTAGGACCACATGGG 0: 1
1: 2
2: 1
3: 8
4: 68
909625986_909625993 12 Left 909625986 1:77716598-77716620 CCAGTAGAAAGCAATTAAGAACC 0: 1
1: 2
2: 2
3: 14
4: 154
Right 909625993 1:77716633-77716655 GGTTAGTCTTAGGACCACATGGG 0: 1
1: 2
2: 1
3: 8
4: 68
909625990_909625993 -10 Left 909625990 1:77716620-77716642 CCGGTAAATCAAAGGTTAGTCTT No data
Right 909625993 1:77716633-77716655 GGTTAGTCTTAGGACCACATGGG 0: 1
1: 2
2: 1
3: 8
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909625993 Original CRISPR GGTTAGTCTTAGGACCACAT GGG Intronic
903308618 1:22433652-22433674 GGTTAGTTCTAGGACTACAGGGG - Intergenic
905720458 1:40195764-40195786 GGTAAGTCTTAAGACTATATTGG + Exonic
909625993 1:77716633-77716655 GGTTAGTCTTAGGACCACATGGG + Intronic
910185658 1:84537308-84537330 GATTAGTCTTAGGGACACCTTGG - Intergenic
917815916 1:178710013-178710035 GGTTAGTCTTTGGTGCACAAAGG + Intergenic
918063044 1:181078666-181078688 GGAAAGTCTTAGAATCACATGGG - Intergenic
921139734 1:212295781-212295803 GGTTAGTCTTTAGGCAACATTGG + Intronic
922075655 1:222241367-222241389 GGTTAGTCTTAAGACCACATGGG - Intergenic
924653084 1:245948478-245948500 TGTTAGTCTAAGGACCACAAGGG - Intronic
1078056756 11:8015455-8015477 GGTGGGTCTTAGGAGCACATTGG + Intergenic
1080322241 11:31024040-31024062 GGTTTATCTTAGGAGCACAAAGG + Intronic
1081612787 11:44573049-44573071 GGTTCGTCTTAGAGACACATAGG - Intronic
1082163214 11:48907245-48907267 TATTATTGTTAGGACCACATAGG + Intergenic
1082234619 11:49808678-49808700 TATTATTGTTAGGACCACATAGG + Intergenic
1082238186 11:49845485-49845507 TATTACTGTTAGGACCACATAGG - Intergenic
1082611479 11:55303996-55304018 TATTATTGTTAGGACCACATAGG - Intergenic
1082658437 11:55879694-55879716 TATTACTGTTAGGACCACATAGG + Intergenic
1084182102 11:67451969-67451991 GGGCAGCCTCAGGACCACATAGG + Exonic
1085648704 11:78246945-78246967 TGTGAGTCTTAGGATCACCTTGG - Intronic
1086696241 11:89849250-89849272 TATTATTGTTAGGACCACATGGG + Intergenic
1086709915 11:89995239-89995261 TATTATTGTTAGGACCACATGGG - Intergenic
1088622104 11:111695924-111695946 GGTTTTTGTTAGGACCATATAGG + Intronic
1088666769 11:112101151-112101173 AGTTAGAGTTAGAACCACATTGG - Intronic
1090545818 11:127766759-127766781 GGTTAGTCTTAGTACTAGAAGGG - Intergenic
1091179984 11:133595860-133595882 GGTTTGTTTTAGAACCACCTAGG - Intergenic
1093387680 12:18578956-18578978 TGCTAGTCTTATGACAACATAGG + Intronic
1096495795 12:52038466-52038488 GGCTAGTATTAGGGGCACATTGG + Intronic
1096508605 12:52114152-52114174 GGTTACTCCTAATACCACATGGG - Intergenic
1103993207 12:124812833-124812855 GGTTATTCTTGGCTCCACATGGG - Intronic
1109208778 13:59510913-59510935 GGTTAGCATTAGGTTCACATAGG - Intergenic
1111446882 13:88357759-88357781 GGTAAGTTTTTGGACCACAATGG + Intergenic
1114777267 14:25498185-25498207 GCATGGTCTTAGGGCCACATGGG - Intergenic
1116292529 14:43062163-43062185 GATTAGTTTTAGGACAACATTGG + Intergenic
1120870404 14:89331583-89331605 GTGTGATCTTAGGACCACATGGG + Intronic
1122196779 14:100093731-100093753 GGTTAGTGCTAGGACCAGAGAGG + Intronic
1133464212 16:6014605-6014627 AGTCAGTCTGAGGACCACAGGGG - Intergenic
1136049644 16:27641333-27641355 GGCTTGTCTTGGTACCACATGGG - Intronic
1137353440 16:47734757-47734779 GTTGAGTCCTAGGACCAGATGGG - Intergenic
1151799204 17:76367752-76367774 GGTTAGTCTTAGGACCACGTGGG - Intronic
1156427782 18:37034121-37034143 TGTTAGTCTTAGGAAAACAAAGG + Intronic
1160035232 18:75294998-75295020 TATTAGTCTTAGGACCAGTTGGG - Intergenic
929728221 2:44455725-44455747 GGTTAGTATAAGGATCACATGGG + Intronic
936316676 2:111430112-111430134 GGGGAGTCTCAGGACCTCATTGG - Intergenic
937716667 2:125039816-125039838 GGTCAGTCTTATGAGCAGATGGG - Intergenic
941854439 2:170216358-170216380 GGTTCTTCTTAAGACCAAATAGG - Intronic
942298593 2:174540489-174540511 AGTTATGCTTAGGACCTCATTGG + Intergenic
947043295 2:225949147-225949169 TGTTAGTCTTAGGGCCCCAAGGG - Intergenic
947235061 2:227932731-227932753 AGTTAAACTTAGGACCACACTGG + Intergenic
1170676126 20:18482526-18482548 GCTTAGGCTTAGGAAGACATAGG + Intronic
1184430875 22:44441025-44441047 GGGAAGTCTAAGGACCACAGTGG - Intergenic
959510197 3:107202209-107202231 GGTCTGTCTTGGGAACACATTGG - Intergenic
962694963 3:137939013-137939035 GGTTGGTCTCAGGACCACAGTGG + Intergenic
966680654 3:182638438-182638460 GGTGAGTCTTAATACCATATGGG + Intergenic
966680879 3:182640782-182640804 GGTGAGTCTTAACACCACGTGGG + Intergenic
967306653 3:188066160-188066182 GGTTAATCCTAAGGCCACATAGG - Intergenic
969169624 4:5349261-5349283 GGCCAGTCTTTGGGCCACATTGG - Intronic
988846984 5:35137224-35137246 GATTGGTCTAAAGACCACATGGG + Intronic
989368033 5:40678554-40678576 AGTTAGTCTCAGCAACACATGGG - Intergenic
995304791 5:110632024-110632046 GGTTAGTCTTTGGTCCCCAGTGG - Intronic
996777569 5:127149169-127149191 GCTTAGTCTTAGTTCCACTTGGG - Intergenic
1001801835 5:174551226-174551248 GGTTGGTCTGAGGACCCCACTGG - Intergenic
1009492133 6:64303971-64303993 AGTTGGTCTTAGGACCACATGGG - Intronic
1011117041 6:83905585-83905607 GGTTAGTCTTTGGGCCCCAGTGG + Intronic
1014858088 6:126427792-126427814 AGTGAGTGTTAGGAACACATAGG + Intergenic
1016389517 6:143561057-143561079 GATTAGTCTTAGGACAAGATAGG + Intronic
1022122680 7:27324525-27324547 GGTTAGTTCTAGGGCCATATGGG - Intergenic
1026803263 7:73413146-73413168 GGTCAATGTTAGGACCAAATGGG - Intergenic
1030886381 7:114943479-114943501 GGTTAATTTTAGGACCATTTTGG + Intronic
1031105794 7:117541115-117541137 ACTTAGTCTCAGGACCAAATAGG - Intronic
1031162709 7:118187711-118187733 GGTGTGTCTTATGATCACATGGG - Intronic
1034921639 7:155088057-155088079 GGTTATTGTTAGGACCAAATAGG - Intergenic
1034952052 7:155305223-155305245 GGTTAGGCTTAGAACCTCAGAGG - Intronic
1037321217 8:17645134-17645156 GGATAGTGTTAGGCTCACATGGG + Exonic
1045853816 8:106738067-106738089 GGTTGGTATTAGGAGTACATTGG + Intronic
1046612778 8:116444330-116444352 GCTGAGTGTTGGGACCACATGGG - Intergenic
1054907927 9:70426944-70426966 CGTTAGTATTAGCATCACATGGG - Intergenic
1188964811 X:36537641-36537663 GGTTAGTCTTGGGAACAAAAAGG - Intergenic
1198141974 X:133813413-133813435 GGTTAGTCTTCGGAGTACATAGG - Intronic
1202142663 Y:21744377-21744399 CGTTAGTTTTAAGATCACATGGG - Intergenic
1202144195 Y:21761241-21761263 CGTTAGTTTTAAGATCACATGGG + Intergenic