ID: 909626186

View in Genome Browser
Species Human (GRCh38)
Location 1:77718718-77718740
Sequence GAAAATGCAGAGATCCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 322}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909626186 Original CRISPR GAAAATGCAGAGATCCAGCC TGG Intronic
901948416 1:12722034-12722056 GAAAACGAAGAGATGAAGCCGGG + Intronic
902566698 1:17316031-17316053 GAAAAGGCAGGGAGCCAGGCTGG - Intronic
902942637 1:19811655-19811677 GACAAACCAGAGAGCCAGCCCGG - Intergenic
903048394 1:20582318-20582340 AAAAATGCAAAGAATCAGCCGGG + Intergenic
903329059 1:22587863-22587885 GAAAATGCACAGATCTGGGCAGG - Intronic
904525762 1:31132716-31132738 AAAATTGCAAAGATGCAGCCAGG + Intergenic
904915778 1:33969815-33969837 GAAAAGGCAGAAATTCAGCCGGG + Intronic
904923373 1:34026582-34026604 TAAAATGCAGAGGTGCAACCAGG + Intronic
904932710 1:34102694-34102716 GCAAATGCAAAGGTCCAGCATGG - Intronic
905305095 1:37012302-37012324 TAAAATACAGTGATCCTGCCTGG - Intronic
905566972 1:38973396-38973418 TAAAATCCAGAGACCCAGGCTGG + Intergenic
907199448 1:52713867-52713889 GAAAATGTCTAGAGCCAGCCTGG + Intergenic
907322873 1:53616760-53616782 CACAATCCGGAGATCCAGCCCGG + Intronic
909626186 1:77718718-77718740 GAAAATGCAGAGATCCAGCCTGG + Intronic
909951157 1:81721995-81722017 GAAAATGCAGAGATAGGACCAGG + Intronic
910284932 1:85543341-85543363 GAGAATGCTGGGATCCAGCCGGG + Intronic
910491751 1:87780036-87780058 GAAAATTCAGAGCCACAGCCAGG + Intergenic
912059942 1:105655200-105655222 AAGAATGCTGAGCTCCAGCCTGG - Intergenic
912738157 1:112168522-112168544 GAAAGCACAGAGATCCAGGCTGG + Intergenic
915697917 1:157762984-157763006 GAAAATGCATAGGTAAAGCCAGG + Intronic
916277129 1:163007238-163007260 GAAAATGCAGAAAACAGGCCGGG + Intergenic
916483436 1:165235860-165235882 GAAAATGCAGATAAAGAGCCCGG - Intronic
918142688 1:181732447-181732469 GCACATGCAGATGTCCAGCCAGG + Exonic
918173006 1:182016036-182016058 AAAAATGAAGGAATCCAGCCTGG - Intergenic
918420489 1:184359809-184359831 GAAAATGCTGAGGTCAAGTCAGG - Intergenic
920049957 1:203157877-203157899 GCAAATGCCGAGGTCCTGCCTGG + Intronic
921154539 1:212428882-212428904 GAAAATGCTACAATCCAGCCAGG + Intergenic
922172419 1:223166957-223166979 GAAAATGCCAAGATCTAGCTGGG - Intergenic
922963111 1:229664894-229664916 GAGGATGCAGAGAGCCAGCGGGG - Intergenic
923537956 1:234867543-234867565 GAACATGCAGAGATTCTCCCTGG - Intergenic
1062883689 10:999571-999593 GAAAATGCAGAAATCCACACTGG - Intronic
1065812106 10:29451761-29451783 GGAACTGCAAAGATCCAGCAGGG - Intergenic
1066477603 10:35763195-35763217 GTAAATAGAGAGACCCAGCCAGG - Intergenic
1067184243 10:44013654-44013676 GAAGATGCAGAGATACAGAAAGG - Intergenic
1067477986 10:46578880-46578902 GAAACCGCAGGGCTCCAGCCAGG - Intronic
1067576836 10:47414456-47414478 GAAGATGGTGAGAGCCAGCCCGG - Intergenic
1067616753 10:47762907-47762929 GAAACCGCAGGGCTCCAGCCAGG + Intergenic
1068332728 10:55592421-55592443 CAAAACTCAAAGATCCAGCCAGG + Intronic
1069600735 10:69705182-69705204 GAAAATGTAAAGATCCAGCCTGG - Intergenic
1069827219 10:71261724-71261746 GCAGATGCAGGGCTCCAGCCAGG - Intronic
1070147327 10:73784518-73784540 GAAAATGCAAAGAATTAGCCAGG - Intergenic
1071248767 10:83793438-83793460 GAAAATGCAGGGATTCATCTGGG - Intergenic
1071304597 10:84287431-84287453 AATAATACAGAGATCCAGGCAGG - Intergenic
1071827680 10:89341304-89341326 AAAAGGGCAGAGATCCATCCAGG + Intronic
1072521433 10:96233227-96233249 GCAAATGCAGTTATCCAGGCAGG - Intronic
1072926145 10:99619482-99619504 GAGAATGCAGAATTCCAGACTGG - Intronic
1073330931 10:102669479-102669501 GAGAATGCTGGGCTCCAGCCCGG + Intergenic
1073335080 10:102701030-102701052 AAAAATGAAGACTTCCAGCCCGG - Intronic
1074863736 10:117532825-117532847 CAAACTGCAGGGCTCCAGCCTGG - Intergenic
1075418074 10:122280325-122280347 GGAAACCCAGAGATCCAGCACGG + Intronic
1076134284 10:128034630-128034652 GAAACTGCAGTGAGCCAGTCTGG + Intronic
1076167415 10:128293651-128293673 GAAGAAGCAGAGACCCACCCAGG - Intergenic
1077265508 11:1647088-1647110 GAAAATGCAAAGAACCGGCTGGG - Intergenic
1078170603 11:8926355-8926377 GCAAAGGCAGAGCTTCAGCCTGG + Intronic
1078397165 11:10991495-10991517 AAAACTGCAGAGAGCCAGGCAGG - Intergenic
1078477728 11:11646350-11646372 GAAAATGCAGATCTCCTGCCTGG - Intergenic
1078716080 11:13840140-13840162 AAAAATGCAGAGTTCTACCCCGG + Intergenic
1079810301 11:24990539-24990561 GTAAATGCAGAGATGAAGACTGG + Intronic
1080161270 11:29179654-29179676 GAAAATGCAGGTCTCCAGTCGGG - Intergenic
1083556087 11:63629528-63629550 GAAAATGCAGGGATACAGAGAGG + Intronic
1086451146 11:86918216-86918238 GTAAATGCAGAGATGAAGCTTGG + Intronic
1087085298 11:94212199-94212221 GAAAGGGCAGAGATCCAGTGGGG + Intergenic
1087841424 11:102924594-102924616 GAGAATGAAAAGATCCATCCAGG + Intergenic
1089066448 11:115665710-115665732 CCAAATTCAGAGATCCAACCAGG + Intergenic
1090329650 11:125921072-125921094 GAAAATTTAGAAATCCAACCAGG - Intronic
1090962835 11:131572445-131572467 GAAAATGGTAACATCCAGCCTGG - Intronic
1090983826 11:131748492-131748514 GAGAATGAATAGATCTAGCCTGG - Intronic
1091596509 12:1882453-1882475 GAAAATGCAGGGACCCAGGAAGG + Intronic
1091994302 12:4981216-4981238 CAAAATGTGGAGATCCAGCTGGG + Intergenic
1092567094 12:9678016-9678038 GGAAATGCACAGATCCAGCAGGG - Intronic
1092736466 12:11587570-11587592 GGAAAGACAGAGATACAGCCAGG - Intergenic
1093069989 12:14698787-14698809 GAAACTGAAGAGCTACAGCCTGG + Intergenic
1093459266 12:19393727-19393749 CAGAATGTAGAGATCCAGGCTGG + Intergenic
1094107442 12:26829549-26829571 AAGAATGCCGTGATCCAGCCTGG - Intronic
1095541941 12:43320388-43320410 GAAAATGCAGATTCCCTGCCAGG + Intergenic
1096059584 12:48685466-48685488 CCAAATGCATATATCCAGCCTGG + Intergenic
1096081381 12:48835275-48835297 TAAAAATCAGAGATTCAGCCAGG + Intronic
1098367392 12:69719106-69719128 AAAAATGCAGAGCTCCAGAGTGG - Intergenic
1098861918 12:75720132-75720154 AAAAATGCAGACATCTGGCCGGG + Intergenic
1099241332 12:80142849-80142871 GAAGATGTAGAGATACAGCAGGG + Intergenic
1100676558 12:96874911-96874933 AAAAAAGCAGAGATCCCGGCCGG - Intronic
1101071727 12:101082397-101082419 GAAAATGGACAGATACATCCAGG + Intronic
1102219965 12:111187707-111187729 GTCCATGCAGAGCTCCAGCCTGG + Intronic
1102713159 12:114946198-114946220 AAAAATACAGAGATCAAGCAGGG + Intergenic
1102797808 12:115704117-115704139 TAAAAAGTAGAGATCCAGGCAGG + Intergenic
1103038427 12:117675142-117675164 GTAAATGCAGAATTCCAGCTGGG - Intronic
1104357622 12:128101634-128101656 GACCATGCAGAGATGGAGCCAGG - Intergenic
1104653088 12:130551676-130551698 GAAAATGCACAGATAGAGCAAGG + Intronic
1106211926 13:27657232-27657254 AAAAATACAGATCTCCAGCCAGG + Intronic
1106315064 13:28586130-28586152 GAAAATGTAGATCTCCAGCTTGG + Intergenic
1107218348 13:37949153-37949175 GAAAGTGCAGAGAGCCAGAGAGG - Intergenic
1107421749 13:40253845-40253867 GAGAATGCAGGGCCCCAGCCAGG - Intergenic
1108539948 13:51432106-51432128 GAAAATGCAGAGATTTAAACTGG - Intronic
1108774488 13:53748794-53748816 GAAAATTCAGATATCCAACTTGG - Intergenic
1109326668 13:60876342-60876364 AAAAATTCTGAAATCCAGCCAGG + Intergenic
1110278571 13:73666003-73666025 GAGAATGAAGAGATTCTGCCTGG - Intergenic
1114612343 14:24051430-24051452 GGGGATCCAGAGATCCAGCCTGG - Intergenic
1115509456 14:34125542-34125564 GAAAATGTAGGGGTCAAGCCTGG + Intronic
1116046191 14:39746013-39746035 GAAAAGGCAGAGTTTCAGCAGGG - Intergenic
1117043670 14:51791039-51791061 GAACATCCAGAGGTCCAGCATGG + Intergenic
1117490160 14:56239192-56239214 GAAAATGCAGAGAGCAAGACAGG - Intronic
1119535187 14:75397092-75397114 CAAAATGCAGAGATACTGCCTGG + Intergenic
1119664528 14:76475167-76475189 AAGGATGCAGAGAGCCAGCCTGG + Intronic
1120275846 14:82371240-82371262 GGGAATCCAGAGATCCAGTCTGG - Intergenic
1120765695 14:88324922-88324944 GAGAATTCAGGGCTCCAGCCTGG - Intronic
1121181931 14:91935506-91935528 GAAAATGCAGAGATAGAGGTGGG - Intronic
1121679797 14:95783977-95783999 TTAAAAGCACAGATCCAGCCAGG - Intergenic
1122803617 14:104245408-104245430 GGAAACCCAGAGATCCATCCTGG - Intergenic
1123998919 15:25738342-25738364 TAAAAAGCAGATATCCAGCTAGG + Intronic
1124212201 15:27772545-27772567 GAAAATGGAGAGAACTGGCCGGG + Intronic
1124384521 15:29195386-29195408 GAAACTGCAGAGAGCCACCTCGG - Intronic
1125688884 15:41580590-41580612 GAAAATGCAAATATTCAGCTGGG + Exonic
1127875286 15:63106608-63106630 AAAAATACAAAAATCCAGCCGGG - Intergenic
1128764200 15:70241188-70241210 CAAAATGGACAGTTCCAGCCAGG + Intergenic
1129045129 15:72727137-72727159 GAAGATGCAAAGCCCCAGCCAGG - Intronic
1129098170 15:73231717-73231739 GAATATGCAGGCATCCATCCTGG + Intronic
1129919467 15:79307892-79307914 GAAAATGCAGAAGTCCAGAAGGG - Intergenic
1130233851 15:82116490-82116512 TTAAATGTAGAGACCCAGCCAGG - Intergenic
1131835759 15:96389000-96389022 GTAAATGGAGAGCTCCAGCTTGG + Intergenic
1132161258 15:99545061-99545083 AAAAATACAGAAATCTAGCCAGG + Intergenic
1132429603 15:101749911-101749933 GAAAATGTATAGACCCAGCATGG + Intergenic
1132768009 16:1544623-1544645 AGAAATGCAGTGATCCAGCTGGG - Intronic
1133112769 16:3558763-3558785 GAAAAAGAAGAGCACCAGCCTGG - Intronic
1133119431 16:3597114-3597136 GAAAATGCAGAGTCCCGGCCGGG - Intronic
1133158422 16:3892132-3892154 GAAAATGTAAACATCCAGCCAGG - Intergenic
1133926022 16:10192974-10192996 GACAGTGCTGAGATCCACCCCGG - Intergenic
1134138350 16:11695713-11695735 GACAGTGAAGAGATGCAGCCAGG - Intronic
1134805307 16:17119136-17119158 GAAAGAGCAGGGAACCAGCCAGG - Intronic
1135148049 16:19980298-19980320 AAAAATGCAGATTTCCAGCATGG + Intergenic
1136099626 16:27984285-27984307 GAACATGTAGCAATCCAGCCAGG + Intronic
1137237818 16:46629716-46629738 GAAAAAGCAGACACCCAGCGAGG + Intergenic
1137352546 16:47726243-47726265 AGAAATGCAGAGAAACAGCCCGG - Intergenic
1137380903 16:47998768-47998790 GTAAGAGCAGAGATGCAGCCAGG - Intergenic
1137754234 16:50888761-50888783 GAGAATAAACAGATCCAGCCTGG + Intergenic
1137952912 16:52800592-52800614 AAAAATGCAGAAAGCCAGGCAGG + Intergenic
1139667137 16:68465263-68465285 TAAAAAGCAGAGAAGCAGCCAGG - Intergenic
1139858365 16:69999646-69999668 GAAAATGCAAAAATTAAGCCGGG - Intergenic
1140468815 16:75203611-75203633 GAAAATGCAGAGAGGGAGGCGGG + Intergenic
1141839527 16:86565917-86565939 GACAATGCAGCGACCCACCCGGG - Intergenic
1142646930 17:1320172-1320194 AAAAATGCAAAGGACCAGCCAGG + Intergenic
1143330337 17:6130281-6130303 GAGAATGCAGAGACACAGCAAGG + Intergenic
1143595289 17:7910362-7910384 GGAAATACAGAGATGGAGCCAGG - Intronic
1144028964 17:11302842-11302864 GAAAAAGCAGAGAGTCATCCAGG + Intronic
1144682690 17:17205990-17206012 GAACAGGCAGAGATCCAGGCTGG + Exonic
1146287365 17:31582873-31582895 GAAAATGAAGAGATGAGGCCAGG + Intergenic
1148247316 17:46042066-46042088 GAAAATACAGAAAACTAGCCGGG - Intronic
1149195147 17:54110696-54110718 CAGTAAGCAGAGATCCAGCCTGG + Intergenic
1149439982 17:56665893-56665915 CAACACACAGAGATCCAGCCTGG + Intergenic
1149720631 17:58840576-58840598 GAAAATGTACAGAACCAGCCTGG + Intronic
1149778653 17:59378630-59378652 TGAAAGGGAGAGATCCAGCCAGG - Intronic
1150465255 17:65387146-65387168 GAATATGCAGAGACCCGGCGCGG - Intergenic
1150658840 17:67058288-67058310 AAAGACGCAAAGATCCAGCCAGG + Intergenic
1151152305 17:72098576-72098598 GAAAATGCTGAGATCCAAAGAGG - Intergenic
1152708314 17:81857129-81857151 TAAAATGCAGAGGGCCATCCTGG - Intronic
1153534885 18:6090842-6090864 GAATATCCAGAGTTCCAGTCTGG - Intronic
1153773980 18:8436914-8436936 GAACATGGAGAGATGCTGCCTGG + Intergenic
1153882005 18:9429378-9429400 GAAAAGGTACAGATCCTGCCTGG - Intergenic
1154207968 18:12354173-12354195 GAACATCCAGAAATCCAGGCAGG - Intronic
1157576775 18:48748948-48748970 AGAGATGCAGAGATGCAGCCTGG - Intronic
1158995922 18:62919409-62919431 GAAAAAACAGACATACAGCCAGG + Intronic
1160044874 18:75377172-75377194 TTAAATGCAGAGAAGCAGCCAGG - Intergenic
1160284282 18:77525791-77525813 GGCAATGCGGAGACCCAGCCAGG - Intergenic
1160903920 19:1443336-1443358 GAAAGTGCTGTGCTCCAGCCTGG + Intergenic
1161422985 19:4185847-4185869 GCAGAGGCAGAGACCCAGCCAGG + Intronic
1162097172 19:8317130-8317152 GGAAATGCAGAGATCTTGACAGG - Intronic
1162370885 19:10278604-10278626 GAGGTTGCAGTGATCCAGCCTGG - Intronic
1163144816 19:15373178-15373200 GTGAATGCCGAGACCCAGCCCGG - Exonic
1163952780 19:20606044-20606066 GAAAGTGAAGACATCCAGGCAGG - Intronic
1166344279 19:42155703-42155725 GGAGATCCAGAGATCCGGCCTGG - Intronic
1167398384 19:49247003-49247025 GAAAATGCAAAGGACCGGCCGGG - Intergenic
1167936757 19:52915144-52915166 GAAAATGCAAAGATCCACAAGGG + Intergenic
1168673213 19:58257214-58257236 AAAAATGCCAAGAACCAGCCAGG - Intronic
925115429 2:1374399-1374421 GAAAACACAGAGATCCTACCAGG - Intronic
926334468 2:11852983-11853005 GGAACTGCAGAGACCCAGGCAGG + Intergenic
926753040 2:16214249-16214271 GTAAAAGCAAAGATCAAGCCTGG - Intergenic
926847162 2:17154324-17154346 GAAAAGGCAGAGACCACGCCGGG + Intergenic
927240791 2:20918262-20918284 GACAACGCAGAGAGCCAGCCAGG - Intergenic
927398079 2:22678503-22678525 GAATATGCACTGATACAGCCAGG + Intergenic
928402067 2:30986209-30986231 GAAAACACACAGACCCAGCCAGG + Intronic
929753346 2:44740423-44740445 AAAATTGCAGCAATCCAGCCGGG - Intronic
930105567 2:47636405-47636427 AACAATGCAGAGATTCACCCAGG - Intergenic
930636842 2:53815807-53815829 GAATATGTAGTGATCCAGTCAGG + Intronic
931096703 2:58948487-58948509 GTAAAAGCAGAGATGCACCCAGG - Intergenic
931510985 2:62993875-62993897 GAAAAGGCAGAGATCAATACAGG + Exonic
932471174 2:71959856-71959878 AGAAATGCACAGATCCAGCAGGG - Intergenic
933694890 2:85210326-85210348 GAAACTACAGGGCTCCAGCCAGG - Intronic
934966349 2:98727240-98727262 GAAAATGCAGCAATCCAGCCAGG + Intronic
936473376 2:112818590-112818612 AAAAATGCAGGGATCCAGCCTGG + Intergenic
936476988 2:112847984-112848006 GAACATGAGGACATCCAGCCAGG - Intergenic
936954432 2:118010248-118010270 CAAAATGCTGAGATACGGCCAGG - Intronic
937003669 2:118491371-118491393 GAAAATGCAGAGGTACAGCATGG + Intergenic
937222595 2:120350414-120350436 GAAGAAGCAGACATCGAGCCAGG - Exonic
938030456 2:127988125-127988147 TAAAATTCATAGCTCCAGCCAGG + Intronic
938131467 2:128719120-128719142 GAGATTGCAGTGATCCTGCCTGG + Intergenic
938593593 2:132764193-132764215 GTAAAACCAGAGAACCAGCCAGG + Intronic
940708655 2:157135436-157135458 AAAAAGGCAGAGAGCCTGCCAGG - Intergenic
941052133 2:160746901-160746923 GCAAATGCAGAGACCCAGCAGGG - Intergenic
941594231 2:167455806-167455828 AATAATGGAGAGATCCAGCCAGG - Intergenic
941807994 2:169728651-169728673 GAGAATTCAGATATGCAGCCAGG - Intronic
944181850 2:196904387-196904409 GAAAATGAAGAGACCCACACAGG + Intronic
944538846 2:200737862-200737884 AAATCTGCAGAGATCCAGGCTGG + Intergenic
944583604 2:201154382-201154404 GAAAATGGAGAGAATAAGCCAGG - Intronic
945322706 2:208444087-208444109 GCAAAGGCACAGATCCAGACAGG - Intronic
947951368 2:234150382-234150404 GAAACTGCAGAGACCCTGCTGGG - Intergenic
947958862 2:234217897-234217919 GAAAAGGCAGAGAAACGGCCAGG + Intergenic
948786983 2:240357994-240358016 GAAAATGCAGTCGTCAAGCCCGG + Intergenic
1169212747 20:3776971-3776993 GTAAATCCTGAGATCCAGCTGGG - Intergenic
1170008066 20:11690522-11690544 TAAGATGCAGAGACCCATCCAGG + Intergenic
1173145248 20:40519328-40519350 GGAAAGACAGAGATCCAGCAAGG + Intergenic
1174647890 20:52101821-52101843 AAAAATGCAGAGTCTCAGCCGGG + Intronic
1174830964 20:53812020-53812042 GAAAAATCAGAGATCCTGACTGG + Intergenic
1178095991 21:29216545-29216567 ATATATGCAAAGATCCAGCCTGG - Intronic
1178725559 21:35048390-35048412 GCACATGCACAGAGCCAGCCAGG - Intronic
1181377676 22:22473029-22473051 GCAAATGCAGAAATCCAGAAGGG - Intergenic
1182306504 22:29372987-29373009 TAAAATGGGGAGATCAAGCCGGG + Intronic
1182593913 22:31403370-31403392 GAAAATGCAGAGAAAGGGCCGGG + Intronic
1182673167 22:32015116-32015138 GAAAAAGCAGAGATGAGGCCGGG + Intergenic
1183977882 22:41523695-41523717 GAAAATGAAGAGGCCCTGCCAGG - Intronic
1184280360 22:43434082-43434104 GAGGATGCCAAGATCCAGCCGGG - Intronic
1184407970 22:44311003-44311025 GGAACAGCAGAGATCCAGGCAGG + Intronic
1184757032 22:46522701-46522723 GGAAAAGCAGAGATCCAGCCTGG - Intronic
949129354 3:482733-482755 TAAAATGCAAAGGACCAGCCGGG + Intergenic
952171598 3:30812990-30813012 GAAAATGCAGTGAGGAAGCCTGG + Intronic
952716078 3:36482340-36482362 GAAAAGGCAGAGAGCCATCCTGG - Intronic
952931399 3:38363869-38363891 GAAAATACAGTAATCCAGCATGG - Intronic
954856763 3:53650528-53650550 CAAAATGCAGTCATGCAGCCTGG + Intronic
955015087 3:55062407-55062429 GAAAATGAGAAGATACAGCCAGG - Intronic
955310777 3:57884646-57884668 AAAAATGCAAAGAATCAGCCGGG + Intronic
956043306 3:65169460-65169482 GAAAAAGCAGGAAGCCAGCCAGG + Intergenic
956643716 3:71436303-71436325 GAAAATCCTAAGATGCAGCCTGG + Intronic
957560381 3:81813661-81813683 CAAAATGCAAAGATCCAGCTTGG + Intergenic
958454589 3:94314650-94314672 GGAATTGCTGAGAACCAGCCAGG + Intergenic
960894916 3:122493599-122493621 GAAAATTAAGAAAACCAGCCTGG + Intronic
961008564 3:123421318-123421340 GAGAAAGCAGAGACCCAGACAGG + Intronic
961378217 3:126481160-126481182 TAAAATGGACAGATCCAGCGGGG - Intergenic
961401031 3:126643103-126643125 GAAGATGCAGGGACCCAGCAGGG + Intronic
961915275 3:130367963-130367985 GAAGATGCAGAGTTCTTGCCTGG - Intronic
963154295 3:142079091-142079113 GAAAATACACAGTCCCAGCCTGG + Intronic
963496796 3:146074302-146074324 GCAAATACAGAGAGCCAGCAGGG + Intronic
963920772 3:150902630-150902652 GCTGAGGCAGAGATCCAGCCAGG - Intronic
964217208 3:154299110-154299132 AAAAATGCAGAAAGTCAGCCGGG + Intronic
964472344 3:157068759-157068781 GCAAAGGCAGAGATGCTGCCTGG + Intergenic
966175081 3:177129847-177129869 AAAAATGCACATATCCAGCAGGG + Intronic
968637791 4:1690982-1691004 GATAATTCAGAGATGGAGCCAGG - Intergenic
969241707 4:5903002-5903024 GAAAATGCAGAGGCCCAGGGAGG - Intronic
969685580 4:8672250-8672272 GCGAATGCTGAGACCCAGCCTGG - Intergenic
974489416 4:62545441-62545463 GGTAATCCAGAGATCCAGGCTGG + Intergenic
975114417 4:70663349-70663371 AAAAATACAAAGATCTAGCCAGG - Intronic
976665684 4:87588357-87588379 GATAATGTAGAGATCAGGCCTGG - Intergenic
977083664 4:92566463-92566485 GAGAATGAATAGATCCAGTCAGG - Intronic
982089282 4:151866580-151866602 TCAAATGCAGAGCTGCAGCCTGG + Intergenic
984636379 4:182114884-182114906 CAAAATCCACAAATCCAGCCAGG + Intergenic
985298906 4:188466205-188466227 GGAAATGCAGAAATCCAGGCAGG - Intergenic
985821438 5:2163449-2163471 GAAGATGCAGTGGTCCAGCCAGG - Intergenic
986292975 5:6415200-6415222 GAAGATGCAGAGATGCAGAGGGG - Intergenic
986509457 5:8488690-8488712 GAATCTGCAGTGATGCAGCCAGG - Intergenic
986874517 5:12091884-12091906 GAGAGTGGAGAGATGCAGCCAGG + Intergenic
987299054 5:16580818-16580840 GAAAATGCAGAGACCTCACCTGG + Intronic
987467623 5:18291223-18291245 AAAAATCCAGAGCTCCAGCCAGG + Intergenic
988342785 5:29996100-29996122 GAAAATGAAGAAATCCAACATGG - Intergenic
989386386 5:40858704-40858726 GAAAATGCAGAAATAAGGCCAGG + Intronic
990330452 5:54720229-54720251 TAAAATGAAGAGATTCACCCAGG - Intergenic
990464589 5:56060110-56060132 GAAAATGCAGATTCCCAGCCGGG + Intergenic
990835521 5:60014980-60015002 AAAAATTCTGAGATCCAGCTGGG - Intronic
991327988 5:65459172-65459194 GAAAATGTAGAGAAACAGGCCGG - Intronic
991958161 5:72016216-72016238 GGAAATGCAGAGATCCACAGAGG - Intergenic
992037814 5:72798301-72798323 GAAAAGGCAGAGATGCAGGGTGG + Intergenic
996286892 5:121804487-121804509 GAAAAATCAAACATCCAGCCAGG - Intergenic
997374775 5:133389939-133389961 GAAAAGTCAGAGAGCTAGCCAGG + Intronic
997607217 5:135183843-135183865 GAAAATGCAAAGCACGAGCCAGG + Intronic
998672910 5:144373953-144373975 GAAACTGCAGTGATGCAGCTAGG - Intronic
1000105578 5:158055883-158055905 CAGGATGCAGAGAGCCAGCCAGG - Intergenic
1001020763 5:168180598-168180620 TAAAATGCAGATTCCCAGCCAGG + Intronic
1001409863 5:171503374-171503396 GAAAATCAAGAGACTCAGCCAGG + Intergenic
1001419739 5:171577585-171577607 GATGATGCAGAGAGGCAGCCTGG + Intergenic
1005515145 6:26547529-26547551 AAAAATGCAGAGACACGGCCGGG - Intergenic
1006453324 6:34117848-34117870 GGAAATACATAGATGCAGCCAGG + Intronic
1006612382 6:35302020-35302042 TAAAAGACACAGATCCAGCCAGG - Intronic
1006901240 6:37503209-37503231 GCACATACAGAGACCCAGCCTGG + Intergenic
1007306255 6:40907731-40907753 CAAAATGGAGAGTTCCAGCAGGG + Intergenic
1011503174 6:88013091-88013113 GAAGATGCAGAGATTTAGACAGG + Intergenic
1012855961 6:104502070-104502092 GAAGATTCAAATATCCAGCCAGG + Intergenic
1014159584 6:118152570-118152592 GAAAAAAGAGAAATCCAGCCAGG - Intronic
1014702242 6:124704682-124704704 GATAATGCAAACATCCAACCAGG - Intronic
1015290605 6:131534686-131534708 GAAAATGCAGCGATCCAGTGAGG + Intergenic
1016013210 6:139159583-139159605 GCAGCTGCAGAGCTCCAGCCAGG - Intronic
1017926584 6:158915898-158915920 GAAAATGAAGAGATGGAGGCCGG + Intergenic
1018003015 6:159596618-159596640 GAAAATGCAGAGCCCCAGTTGGG + Intergenic
1018389205 6:163329917-163329939 GAAACTTTAGAGATCAAGCCTGG - Intergenic
1018595558 6:165476879-165476901 GAAAATGCCAAATTCCAGCCAGG - Intronic
1021521189 7:21540696-21540718 GCTAATGCAGGGAACCAGCCTGG - Intergenic
1024298227 7:47863270-47863292 GAAACTGCACAGACCCAGCATGG - Intronic
1025947039 7:66112609-66112631 CAAAGTGCTGAGATCAAGCCTGG + Intronic
1026157451 7:67839350-67839372 AAAAATGCATATATCCAGGCTGG - Intergenic
1026736514 7:72952405-72952427 GAAAATGCAGTGAGACAGTCTGG + Intergenic
1026786744 7:73306476-73306498 GAAAATGCAGTGAGACAGTCTGG + Intronic
1026994176 7:74605215-74605237 GCAGAGGCAGACATCCAGCCTGG + Intergenic
1027107220 7:75412657-75412679 GAAAATGCAGTGAGACAGTCTGG - Intergenic
1027176423 7:75906643-75906665 GACAATGAAGAGAGCCAGGCGGG + Intronic
1028746236 7:94329711-94329733 GAAAATCAAGAGACCCAGTCTGG + Intergenic
1029368832 7:100134546-100134568 GAAATTCCAGACATCCGGCCAGG + Intergenic
1029462159 7:100701529-100701551 GAAAATGGGCAAATCCAGCCTGG - Intergenic
1030043042 7:105469060-105469082 GAAAATTCAAAGAACTAGCCTGG - Intronic
1032163020 7:129525203-129525225 GAAAAGGCAGAGGAGCAGCCGGG - Intergenic
1032193323 7:129776563-129776585 TAAAATGCAGATTTCCAGGCAGG - Intergenic
1032221220 7:129995695-129995717 GAAAATGAACACATTCAGCCAGG + Intergenic
1032448092 7:132001923-132001945 AAAAATGAAAAGAACCAGCCAGG + Intergenic
1033158577 7:138977575-138977597 AAAGATGCAGAAATCCAGCCTGG + Intronic
1034164538 7:149015180-149015202 AAAACTGCAGAGATGCAGCCAGG - Intronic
1034842866 7:154415747-154415769 GAAAATGCACTTCTCCAGCCTGG - Intronic
1035117139 7:156533983-156534005 GAGAATGAAGAGATCGATCCCGG + Intergenic
1035256969 7:157635663-157635685 GAAAATCCAGATATCCTGGCTGG - Intronic
1035996337 8:4551543-4551565 GAACCTGCAGAGAGTCAGCCAGG - Intronic
1036096287 8:5727714-5727736 AAAAAAGAAAAGATCCAGCCAGG - Intergenic
1036636550 8:10554603-10554625 GAAATTGCTGAGAACCACCCAGG + Intergenic
1037267877 8:17086703-17086725 TAAAATGCAGACATCCACACAGG - Intronic
1038428171 8:27478854-27478876 AAGGATGCAGAGAACCAGCCTGG + Exonic
1039751531 8:40482971-40482993 GCAAATGGAGAGAGCCAGGCAGG - Intergenic
1040080215 8:43276758-43276780 GAAAATGCAAACAGCCAGACCGG - Intergenic
1040525792 8:48223770-48223792 GAAAATGCAGAAATAAACCCAGG - Intergenic
1043875744 8:85484316-85484338 TAAAGTGCAATGATCCAGCCTGG - Intergenic
1044431409 8:92111990-92112012 GAAAATACAGACATGAAGCCAGG - Intergenic
1045223179 8:100218085-100218107 GAAAAAGCAGAGAACTGGCCAGG - Intronic
1047574544 8:126138202-126138224 CAAAATGCAGAGATCCAGAGTGG - Intergenic
1047734664 8:127754712-127754734 GAAAAAGCTGAGGTCCAGACAGG + Intergenic
1047963662 8:130029350-130029372 TAAAATACAGATTTCCAGCCAGG + Intergenic
1048439270 8:134447948-134447970 GAAGGTACAGAGATCCAGCTGGG - Intergenic
1048756621 8:137746745-137746767 GAAAATCCAGAGATATAGGCTGG - Intergenic
1049384320 8:142333568-142333590 GGAAACCCAGATATCCAGCCAGG - Intronic
1050295831 9:4204552-4204574 AAAAATGCAGAGAACCAGGGAGG + Intronic
1050726122 9:8651218-8651240 GAAAATGCAGAGATCCATCGTGG - Intronic
1051925450 9:22319350-22319372 GAAAATGCTGGGACCCTGCCTGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1054735064 9:68742740-68742762 GAAACAGCAAAGATCCAGCATGG - Intronic
1055731687 9:79285391-79285413 GACAATCCAGAGATCCAGACAGG + Intergenic
1055732870 9:79297090-79297112 GAAAATAGAGACAGCCAGCCGGG + Intergenic
1056144981 9:83720374-83720396 GAAAATTCAGAATTCCACCCTGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057056524 9:91965895-91965917 GAAAAGGCAAACACCCAGCCCGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1057808784 9:98241586-98241608 GAAAATGCAGAGACCAAGAAAGG - Intronic
1059329906 9:113528368-113528390 GCAAGTGCAGAGAAGCAGCCTGG - Intronic
1059747943 9:117220881-117220903 GAAAATGCAGAGATGTTCCCTGG - Intronic
1059796839 9:117706747-117706769 GAGAAAGCAGAGATCAAGTCTGG - Intronic
1187654070 X:21449441-21449463 TGAAATGAAGAGATACAGCCTGG + Intronic
1187990370 X:24864275-24864297 AAAAATAAAGAGTTCCAGCCAGG - Intronic
1189704624 X:43747619-43747641 GATAATGCAGTGCTCCACCCTGG - Intergenic
1189993337 X:46615027-46615049 CAAAAAACAGAGCTCCAGCCAGG - Intronic
1190070885 X:47278235-47278257 TAAAATGAAGCAATCCAGCCAGG - Intergenic
1194864209 X:99046191-99046213 AAAAATGGACAGATCCAGCAAGG - Intergenic
1195275818 X:103279133-103279155 AAAAATGTATATATCCAGCCTGG - Intergenic
1195758349 X:108221104-108221126 AAAAATGCAGAAATGCAGCCTGG + Intronic
1196222227 X:113124936-113124958 GAATCTGCATAGATACAGCCAGG - Intergenic
1197697779 X:129569266-129569288 GGAAATGCCGGGTTCCAGCCTGG + Exonic
1198081225 X:133241505-133241527 GAAACTGCAGAGATCCCAACTGG + Intergenic
1198612002 X:138411819-138411841 GAGGATCCAGAGAGCCAGCCTGG - Intergenic
1200125767 X:153813803-153813825 TAAAAGGCTGAGCTCCAGCCTGG - Intronic
1201564778 Y:15354598-15354620 AAAAATACAAAAATCCAGCCAGG + Intergenic