ID: 909629848

View in Genome Browser
Species Human (GRCh38)
Location 1:77759832-77759854
Sequence GCGGCTCCTTCCGGTGTCTC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 118}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909629839_909629848 11 Left 909629839 1:77759798-77759820 CCGCCTCCTGAACTGGCCACTTC 0: 1
1: 0
2: 0
3: 25
4: 282
Right 909629848 1:77759832-77759854 GCGGCTCCTTCCGGTGTCTCCGG 0: 1
1: 0
2: 0
3: 14
4: 118
909629836_909629848 23 Left 909629836 1:77759786-77759808 CCCTCGGGGGGTCCGCCTCCTGA 0: 1
1: 0
2: 0
3: 3
4: 51
Right 909629848 1:77759832-77759854 GCGGCTCCTTCCGGTGTCTCCGG 0: 1
1: 0
2: 0
3: 14
4: 118
909629843_909629848 -5 Left 909629843 1:77759814-77759836 CCACTTCCCGCAGCAGCCGCGGC 0: 1
1: 0
2: 5
3: 51
4: 382
Right 909629848 1:77759832-77759854 GCGGCTCCTTCCGGTGTCTCCGG 0: 1
1: 0
2: 0
3: 14
4: 118
909629841_909629848 5 Left 909629841 1:77759804-77759826 CCTGAACTGGCCACTTCCCGCAG 0: 1
1: 0
2: 0
3: 8
4: 123
Right 909629848 1:77759832-77759854 GCGGCTCCTTCCGGTGTCTCCGG 0: 1
1: 0
2: 0
3: 14
4: 118
909629837_909629848 22 Left 909629837 1:77759787-77759809 CCTCGGGGGGTCCGCCTCCTGAA 0: 1
1: 0
2: 0
3: 8
4: 55
Right 909629848 1:77759832-77759854 GCGGCTCCTTCCGGTGTCTCCGG 0: 1
1: 0
2: 0
3: 14
4: 118
909629840_909629848 8 Left 909629840 1:77759801-77759823 CCTCCTGAACTGGCCACTTCCCG 0: 1
1: 0
2: 3
3: 5
4: 135
Right 909629848 1:77759832-77759854 GCGGCTCCTTCCGGTGTCTCCGG 0: 1
1: 0
2: 0
3: 14
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909629848 Original CRISPR GCGGCTCCTTCCGGTGTCTC CGG Exonic
900395046 1:2450058-2450080 GGGGCTCCTTGAGGTGGCTCAGG - Intronic
900542488 1:3210378-3210400 GCGGCTCCTTCCTGAATCTGAGG - Intronic
900554376 1:3272482-3272504 GAGGCTCCTTCCGGGACCTCGGG + Intronic
900607793 1:3531483-3531505 GCGGCTCCCTCGGTTGTCTGCGG - Intronic
900820095 1:4879925-4879947 GCTGCCCCTTCAAGTGTCTCAGG + Intergenic
902360680 1:15941208-15941230 GCTGCTCCTTCCTGTCCCTCTGG + Intergenic
903216837 1:21848054-21848076 GCGGATCCCTCAGGTGACTCCGG - Exonic
904253160 1:29238520-29238542 GCTGCTGGCTCCGGTGTCTCGGG + Intronic
906240277 1:44238464-44238486 CCGGCTCCTTTCGGTGTATAGGG + Intronic
906282729 1:44565438-44565460 GCGGCTCCTGCGGCTCTCTCTGG - Intronic
906950892 1:50333712-50333734 GCGGCTGCCGCCGGTGTGTCGGG - Intergenic
907477592 1:54715840-54715862 GCGGCTCCTTCCGGCGGCGCGGG - Exonic
909629848 1:77759832-77759854 GCGGCTCCTTCCGGTGTCTCCGG + Exonic
913209540 1:116571182-116571204 GCGCCTCCTTCCTGTGTCCCCGG + Intergenic
914833621 1:151189593-151189615 GCGGTTCCTTTCCATGTCTCAGG + Intronic
918066290 1:181104469-181104491 GCGGCTCCTTCAGTTGTCCTGGG - Intergenic
923148664 1:231215283-231215305 GGGGATCCTGCCGGTGTCTGCGG + Intronic
923305555 1:232685132-232685154 GCTGGTCCTTCATGTGTCTCAGG + Intergenic
1063671660 10:8104254-8104276 GAGGCTCTTGCAGGTGTCTCAGG - Intergenic
1070695717 10:78561718-78561740 GGGGCTCCCTCCTGTGTCCCAGG - Intergenic
1070744273 10:78923444-78923466 GGGGCACCTTCTGGTGTCCCAGG + Intergenic
1070865430 10:79705768-79705790 GCGTCTCCCTCGGGTGTCCCTGG - Intronic
1073250889 10:102119876-102119898 GCGTCTCCTCCCCGTGTTTCTGG + Intronic
1076805650 10:132857299-132857321 TCGGCTCCATCCTGTGACTCAGG + Intronic
1076848860 10:133083253-133083275 GCGGCTGCTGCCGCTGTCTCGGG + Intronic
1078108373 11:8372829-8372851 GCGGCCTCTTCCGGGGGCTCTGG + Intergenic
1083478149 11:62926930-62926952 GCGGCGCCTGCAAGTGTCTCAGG - Intergenic
1084216676 11:67650667-67650689 GCAGCTGCTTCCGCTGTTTCGGG - Intergenic
1088708282 11:112483134-112483156 ATGGCTCCTTCCAGTGTCTGTGG - Intergenic
1089848338 11:121476317-121476339 GCAGCTCCTTACTGTGTATCTGG + Intronic
1097267569 12:57755086-57755108 GCGGCTCCTTCCGGCGGCGGCGG - Exonic
1103901936 12:124307873-124307895 GAGGCTCCTTCCTGCCTCTCTGG + Intronic
1104172379 12:126294539-126294561 ACCGCTCCCTCCTGTGTCTCTGG + Intergenic
1104806194 12:131591014-131591036 GCAGCTCCTTCGGGTATCTCTGG - Intergenic
1105512225 13:21060914-21060936 GCCTCTGCTTCCGCTGTCTCCGG - Intronic
1105821349 13:24083835-24083857 GCTGCTCCTTCCCTTGTCACTGG + Intronic
1106559558 13:30836632-30836654 GCGGCTGCTTTTGGTGTCTATGG + Intergenic
1113903997 13:113811116-113811138 GCTGCTCCTTCTGGTGGCCCTGG + Intronic
1117315193 14:54566282-54566304 GCGGCTCATCCCGGCGGCTCGGG - Intergenic
1122399650 14:101459053-101459075 GGGGCTCCTTCCAGGGCCTCGGG - Intergenic
1122626994 14:103089904-103089926 GAGGCTGCTTCCTGTGTCACAGG + Intergenic
1126055564 15:44726706-44726728 CCGGCTCCCTCCAGTGTCTGAGG + Intergenic
1127465997 15:59245230-59245252 GTGGCACCATCAGGTGTCTCCGG - Intronic
1130965677 15:88695837-88695859 GCGGCTTCTTCTGGAGTCGCTGG - Intergenic
1133277184 16:4646097-4646119 GCGGCTCCGTCGGGGGGCTCTGG + Intronic
1134521690 16:14921780-14921802 GCCGCTCCTTCCTGTCTGTCAGG + Intronic
1134709360 16:16320431-16320453 GCCGCTCCTTCCTGTCTGTCAGG + Intergenic
1135814065 16:25615969-25615991 GCCGCCCCTTCCTGTTTCTCTGG - Intergenic
1138660691 16:58515477-58515499 GCGGTCACTTCCGGCGTCTCTGG - Exonic
1147255188 17:39177119-39177141 GCGGCAGCTTCTGGTGTCTGTGG - Intronic
1148233056 17:45949266-45949288 GCGGCCCCGGCGGGTGTCTCAGG - Intronic
1148581467 17:48747032-48747054 GGGGCTCCTTCTGGGGACTCCGG + Intergenic
1149794363 17:59505771-59505793 GCGGCTCCATCCCATGTGTCAGG + Intergenic
1152538703 17:80964150-80964172 GCAGCTCCTGCCGGGGTCTCAGG - Intronic
1158276899 18:55779296-55779318 GCGGCAGCTTTTGGTGTCTCTGG + Intergenic
1160197747 18:76770687-76770709 GCGACCCCTTCCTGTGTCTCTGG + Intergenic
1160297954 18:77654975-77654997 GCTGCTCCTTCTGGGGGCTCAGG - Intergenic
1160528099 18:79548914-79548936 GCGGCTCCTTCCAGCGTCACAGG + Intergenic
1160540209 18:79617099-79617121 GCGGCTCCTCCCAGGGCCTCAGG - Intergenic
1161853570 19:6751360-6751382 GCGGGTCCGTCCGGTGTGACAGG - Exonic
1163737146 19:18988413-18988435 GTGGTTCCTGCAGGTGTCTCTGG - Intergenic
1166109683 19:40614378-40614400 CCGGCTCCTACCGCTGTGTCCGG + Exonic
1167652567 19:50740943-50740965 GCGGCTCCTACTGTTGTCCCAGG - Intergenic
925335441 2:3095670-3095692 GCGGCTCCTCCCTGGATCTCCGG - Intergenic
927920777 2:26970710-26970732 GCGGCTCCGGCCGGCGGCTCCGG - Exonic
930096687 2:47571056-47571078 GCGACGCCTCCCGGTGGCTCTGG + Intergenic
932130514 2:69183198-69183220 GCGCCTCCTGCCAGTGTATCAGG + Intronic
932629267 2:73324288-73324310 GCGGCCCATTCCAGAGTCTCAGG + Intergenic
933858422 2:86441407-86441429 GCGGCTGCCGCCGGTGACTCAGG + Exonic
936275976 2:111097664-111097686 TTGGCTCCTTCCTGTGTCCCTGG - Intronic
938340067 2:130529884-130529906 GCGTCTCCTCCCAGTGTCGCTGG - Intergenic
938349767 2:130590864-130590886 GCGTCTCCTCCCAGTGTCGCTGG + Intergenic
948430012 2:237912918-237912940 GGGGCTCCTTCTGGTCTCTTAGG - Intergenic
948602136 2:239113305-239113327 GCAGCTCCTCCCACTGTCTCAGG - Intronic
1170435048 20:16317911-16317933 GCGTCTCCTGCCTCTGTCTCTGG - Intronic
1170446580 20:16434251-16434273 TCTGCCCCTTCCGGTGGCTCTGG + Intronic
1171019407 20:21571876-21571898 ACGGCCCCTTCCAATGTCTCAGG + Intergenic
1172568971 20:35954208-35954230 CCGGCTCCTTCCAGTTTCTCCGG + Exonic
1173207359 20:41005592-41005614 GCGGCTCCTTCCTGGGGCACTGG - Intergenic
1173828592 20:46063390-46063412 GCCGCTCCTTCCGCTCTCGCAGG + Exonic
1174148880 20:48472143-48472165 CCAGCTCCTTCCTGGGTCTCCGG + Intergenic
1174202750 20:48818782-48818804 GGGGCACCTTCCTTTGTCTCAGG + Intronic
1175975658 20:62709168-62709190 GCGGCTCTGTCCGGCGCCTCCGG - Exonic
1178978761 21:37243602-37243624 CCGTCTCCTTTCAGTGTCTCTGG - Intronic
1179243256 21:39609989-39610011 GCGGCTCCTTCGTGTGGCGCAGG + Intronic
1179800657 21:43810261-43810283 GCAGCTCCTTCCGGCGAATCCGG - Intergenic
1180105805 21:45617367-45617389 GCGGCTCCTTCCCATGGGTCAGG - Intergenic
1180116867 21:45713350-45713372 GCGGCTCATCCCGGTTTGTCTGG - Intronic
1180157767 21:45986419-45986441 GCGGCTCCTCCCGGTGAGACAGG + Intronic
1181438621 22:22924376-22924398 CCGGCTCCTTCTGGGGACTCTGG + Intergenic
1182572418 22:31249012-31249034 GAGGCTCCTTCAGGTTTGTCTGG - Intronic
1184442563 22:44526777-44526799 GGGGCTCCTGCCGCTGTCTGAGG - Intergenic
1185044851 22:48523686-48523708 GCGGCTCCTTCCTGGGCCCCCGG - Intronic
950447642 3:13047495-13047517 GAGGCTGCTTCCGGTGTCCAGGG + Intronic
956704080 3:71984333-71984355 GCGGCTGCTACAGGTGTGTCTGG - Intergenic
962318035 3:134370932-134370954 ACGGCTCCTTCAGTTGTCCCTGG - Exonic
968894095 4:3388672-3388694 GCTGCCCCTTCTGGTGCCTCAGG + Intronic
969347335 4:6577490-6577512 CCGGCTCCTTCCCGTGACTCTGG - Intronic
970600739 4:17639320-17639342 GCATCTCCTTCCGGTGTTCCTGG + Exonic
973662597 4:53123462-53123484 GCTGCTCCCTCAGCTGTCTCTGG - Intronic
985767974 5:1790779-1790801 GCAGCTCCTGCCGGTGACCCAGG - Intergenic
990449990 5:55924954-55924976 GCGGCTCCTTCCTCCGTCTGCGG + Intergenic
999088008 5:148910653-148910675 CCTGCTCCTTCCTGTGTCACAGG - Intergenic
1000014714 5:157266530-157266552 GCGGCCGCTGCAGGTGTCTCCGG - Intronic
1002066183 5:176652931-176652953 GCGCCTCCTACAGGTGTCCCAGG - Intronic
1002123241 5:177022111-177022133 GCTGCTCCTTCCCGTGTCTTTGG - Intronic
1002426094 5:179176810-179176832 TCGGCTCCTTCCGACGTCTTTGG + Intronic
1002776550 6:332825-332847 GAGGCTCCTTCTGGTCTGTCTGG + Intronic
1006010838 6:31041839-31041861 GCCGCTCCTTCAGTTGTCTTTGG - Intergenic
1016630879 6:146229414-146229436 GAGGCTCCTTCCGGTCCCTATGG - Intronic
1023493405 7:40768321-40768343 TCGGCTGCTTCCTGTGTCCCTGG + Intronic
1023633299 7:42184344-42184366 GCTGCACCTTCAGGTGTCTCAGG + Intronic
1025233609 7:57219091-57219113 CCGGCTCCTTCCCCTGTCTCCGG - Intergenic
1031965981 7:128028866-128028888 GCAGCTCCGTCCGGTGTATCAGG - Exonic
1033188427 7:139251967-139251989 GCCGATCCTTCCGGTGTTTACGG - Exonic
1033586877 7:142780650-142780672 GCGCCTCCTGCCTCTGTCTCTGG + Intergenic
1034582258 7:152055021-152055043 GCAACTCCTCCCTGTGTCTCTGG - Intronic
1034667170 7:152828645-152828667 GCCGCTCATTCCTGTGTCTTAGG + Intronic
1040561134 8:48524294-48524316 GTGGGTCCATCTGGTGTCTCCGG - Intergenic
1044384765 8:91574499-91574521 GGTGCACCTTCCTGTGTCTCAGG - Intergenic
1049313680 8:141947469-141947491 GCTGCTTCTTCCTCTGTCTCAGG + Intergenic
1049786292 8:144452413-144452435 GCATCTCCTTGCGGTGGCTCTGG + Exonic
1057904767 9:98975077-98975099 GCGGCTCCTGGCGGTCTCTACGG - Intronic
1058908569 9:109499964-109499986 GCTCCTCCTTCCGGGGGCTCCGG - Intergenic
1059345781 9:113626954-113626976 TCTGCTCCTTACGCTGTCTCTGG - Intergenic
1059483619 9:114611255-114611277 GAGGCTCCTTCCGGCGTCCCGGG + Exonic
1062572756 9:137193144-137193166 GCAGCTCCTGCTGGTGTCTGGGG + Intronic
1062589919 9:137269335-137269357 GCCGCTCCTTCTGGAGGCTCAGG + Intronic
1062651266 9:137578920-137578942 GCGACTCCTTCCGGGGTGCCGGG + Exonic
1185653714 X:1667715-1667737 GCAGCTCCCTCCGGAGGCTCTGG + Intergenic
1187390924 X:18886229-18886251 TCAGCTCCCTCCGCTGTCTCAGG - Intergenic
1199263490 X:145803169-145803191 ACTGCTGCTTCCAGTGTCTCTGG + Intergenic
1200917063 Y:8580541-8580563 GCGTCTCCCTCTGGGGTCTCAGG + Intergenic