ID: 909629856

View in Genome Browser
Species Human (GRCh38)
Location 1:77759857-77759879
Sequence ATCGCCGGAGACGCCTGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 28
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 25}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909629856_909629876 26 Left 909629856 1:77759857-77759879 CCGCCGCAGGCGTCTCCGGCGAT 0: 1
1: 0
2: 0
3: 2
4: 25
Right 909629876 1:77759906-77759928 GGGAGCCCGCCCCAGGGGCGGGG 0: 1
1: 0
2: 4
3: 19
4: 307
909629856_909629871 19 Left 909629856 1:77759857-77759879 CCGCCGCAGGCGTCTCCGGCGAT 0: 1
1: 0
2: 0
3: 2
4: 25
Right 909629871 1:77759899-77759921 CCTCGATGGGAGCCCGCCCCAGG 0: 1
1: 0
2: 0
3: 5
4: 77
909629856_909629875 25 Left 909629856 1:77759857-77759879 CCGCCGCAGGCGTCTCCGGCGAT 0: 1
1: 0
2: 0
3: 2
4: 25
Right 909629875 1:77759905-77759927 TGGGAGCCCGCCCCAGGGGCGGG 0: 1
1: 0
2: 2
3: 25
4: 300
909629856_909629869 6 Left 909629856 1:77759857-77759879 CCGCCGCAGGCGTCTCCGGCGAT 0: 1
1: 0
2: 0
3: 2
4: 25
Right 909629869 1:77759886-77759908 GGTGGGGGCGGAGCCTCGATGGG 0: 1
1: 0
2: 2
3: 16
4: 164
909629856_909629868 5 Left 909629856 1:77759857-77759879 CCGCCGCAGGCGTCTCCGGCGAT 0: 1
1: 0
2: 0
3: 2
4: 25
Right 909629868 1:77759885-77759907 AGGTGGGGGCGGAGCCTCGATGG 0: 1
1: 0
2: 1
3: 28
4: 300
909629856_909629864 -10 Left 909629856 1:77759857-77759879 CCGCCGCAGGCGTCTCCGGCGAT 0: 1
1: 0
2: 0
3: 2
4: 25
Right 909629864 1:77759870-77759892 CTCCGGCGATAGGGGAGGTGGGG 0: 1
1: 0
2: 0
3: 6
4: 95
909629856_909629873 21 Left 909629856 1:77759857-77759879 CCGCCGCAGGCGTCTCCGGCGAT 0: 1
1: 0
2: 0
3: 2
4: 25
Right 909629873 1:77759901-77759923 TCGATGGGAGCCCGCCCCAGGGG 0: 1
1: 0
2: 0
3: 1
4: 54
909629856_909629874 24 Left 909629856 1:77759857-77759879 CCGCCGCAGGCGTCTCCGGCGAT 0: 1
1: 0
2: 0
3: 2
4: 25
Right 909629874 1:77759904-77759926 ATGGGAGCCCGCCCCAGGGGCGG 0: 1
1: 0
2: 0
3: 14
4: 171
909629856_909629872 20 Left 909629856 1:77759857-77759879 CCGCCGCAGGCGTCTCCGGCGAT 0: 1
1: 0
2: 0
3: 2
4: 25
Right 909629872 1:77759900-77759922 CTCGATGGGAGCCCGCCCCAGGG 0: 1
1: 0
2: 0
3: 4
4: 65
909629856_909629865 -9 Left 909629856 1:77759857-77759879 CCGCCGCAGGCGTCTCCGGCGAT 0: 1
1: 0
2: 0
3: 2
4: 25
Right 909629865 1:77759871-77759893 TCCGGCGATAGGGGAGGTGGGGG 0: 1
1: 0
2: 1
3: 6
4: 148
909629856_909629867 -6 Left 909629856 1:77759857-77759879 CCGCCGCAGGCGTCTCCGGCGAT 0: 1
1: 0
2: 0
3: 2
4: 25
Right 909629867 1:77759874-77759896 GGCGATAGGGGAGGTGGGGGCGG 0: 1
1: 0
2: 5
3: 93
4: 1302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909629856 Original CRISPR ATCGCCGGAGACGCCTGCGG CGG (reversed) Intergenic
907312356 1:53546170-53546192 ATGGCCAGGGACGCCTGAGGAGG + Intronic
909629856 1:77759857-77759879 ATCGCCGGAGACGCCTGCGGCGG - Intergenic
918601982 1:186375160-186375182 CCCGCCGGAGACTCCCGCGGCGG + Exonic
920260487 1:204685102-204685124 TTCCGCCGAGACGCCTGCGGGGG - Intronic
923163750 1:231339582-231339604 ATCGCGGGAGGCGCCCGCGGGGG + Intronic
1066464988 10:35642729-35642751 AGCGCCGGGGAGGCCTGCCGGGG + Intergenic
1102818006 12:115884344-115884366 ATCGGCTGAGAAGCCTGCAGAGG + Intergenic
1124483963 15:30100078-30100100 ATCGCCGGAGCCCCCTCTGGGGG + Intergenic
1124519617 15:30397146-30397168 ATCGCCGGAGCCCCCTCTGGGGG - Intergenic
1124539036 15:30569075-30569097 ATCGCCGGAGCCCCCTCTGGGGG + Intergenic
1124759614 15:32438497-32438519 ATCGCCGGAGCCCCCTCTGGGGG - Intergenic
1134441821 16:14303014-14303036 ATGGGCGGCGGCGCCTGCGGGGG + Intergenic
1144747750 17:17626929-17626951 ATTGCCGGAGAAGCTGGCGGCGG + Intergenic
1151719833 17:75848752-75848774 AACGCCCGGGAGGCCTGCGGGGG + Intronic
1163125981 19:15244434-15244456 ATCGCCGGGGCTGCCTGCTGCGG + Exonic
1164835217 19:31351368-31351390 ATAGCCGGGGAGGCCAGCGGCGG - Intergenic
1166753956 19:45179313-45179335 GTCGGCGGAGGCCCCTGCGGAGG + Exonic
1175326158 20:58129851-58129873 AGCGCTGGAGACGGCTGCGGAGG - Intergenic
1180110262 21:45644029-45644051 ACCGCCGCCGGCGCCTGCGGCGG + Intronic
1183736760 22:39648824-39648846 ATCACAGGAGACGCCTGGGCTGG - Intronic
950012314 3:9732094-9732116 ATCGCCGGGGGCGCCCGCCGGGG - Exonic
950618081 3:14178421-14178443 TTCGCGGGAGACGCCGCCGGTGG - Exonic
986330545 5:6713733-6713755 AGCGCCGGAGCCGCCCGCCGCGG + Intergenic
986476241 5:8136716-8136738 ATGGCCGGAGAAGCCTGGCGTGG - Intergenic
1027232632 7:76281641-76281663 GGCGCCGGCGACCCCTGCGGCGG - Exonic
1034166451 7:149028523-149028545 ATCGCCGGGGACGACTTCCGTGG - Exonic
1043428453 8:80171539-80171561 TTCGCGGGAGTCGCCGGCGGAGG - Intronic
1059437392 9:114284870-114284892 ATGGCTGGAGAAGCCTGTGGGGG + Intronic