ID: 909631081

View in Genome Browser
Species Human (GRCh38)
Location 1:77770639-77770661
Sequence GCAGTCCCCAGAAATACCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909631081_909631083 10 Left 909631081 1:77770639-77770661 CCTGAGGTATTTCTGGGGACTGC No data
Right 909631083 1:77770672-77770694 CAGTTAGTAGAAAAAGTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909631081 Original CRISPR GCAGTCCCCAGAAATACCTC AGG (reversed) Intergenic
No off target data available for this crispr