ID: 909632519

View in Genome Browser
Species Human (GRCh38)
Location 1:77781873-77781895
Sequence GACACTTGTCTGAAAACAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 249}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909632517_909632519 -1 Left 909632517 1:77781851-77781873 CCACTACTTAATCAGTGGTTTTG No data
Right 909632519 1:77781873-77781895 GACACTTGTCTGAAAACAGGTGG 0: 1
1: 0
2: 2
3: 9
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909632519 Original CRISPR GACACTTGTCTGAAAACAGG TGG Intronic
901063120 1:6482796-6482818 GAGAATTGTCTGAACCCAGGAGG - Intronic
902595869 1:17509029-17509051 GACACTTGTCTGGAAAGTGGGGG + Intergenic
903563120 1:24243885-24243907 GAGACTTGTTTGAACCCAGGAGG + Intergenic
903819543 1:26091461-26091483 GACAGTTGTTTGAACCCAGGAGG + Intergenic
904741102 1:32676518-32676540 GAGACTTGTTTGAACCCAGGAGG + Intronic
907516039 1:54994053-54994075 GACACTGGTCTGAGGAGAGGGGG + Intergenic
908223459 1:62032509-62032531 GAAATTTGTCTGTAAACTGGGGG + Intronic
908669573 1:66532150-66532172 TACACTGCTCTGAAAACTGGAGG - Intergenic
909428952 1:75563805-75563827 GACACCTGTTTGAAAACTGATGG - Intronic
909624368 1:77699428-77699450 GACAATCGTCTGAACCCAGGAGG + Intronic
909632519 1:77781873-77781895 GACACTTGTCTGAAAACAGGTGG + Intronic
911897428 1:103455011-103455033 GAGAATTGTTTGAAACCAGGGGG - Intergenic
912152154 1:106872830-106872852 GAGACTTGCCTGAACCCAGGAGG + Intergenic
913070056 1:115290483-115290505 GAGACTTGTTTGAACCCAGGAGG - Intronic
915905585 1:159874498-159874520 GACACATCTCTGATAGCAGGGGG + Intronic
916365369 1:164020931-164020953 GAGAATTGCCTGAACACAGGAGG + Intergenic
916665883 1:166967170-166967192 GCCACTTCTCTCAAAACAAGTGG + Intronic
916692085 1:167200168-167200190 GAGAATTGTCTGAACCCAGGAGG - Intergenic
917761420 1:178163058-178163080 GAGAATTGCCTGAAACCAGGAGG - Intronic
919143358 1:193601671-193601693 GAGAATTGCTTGAAAACAGGAGG + Intergenic
921165436 1:212503509-212503531 GACAATTGTTTGAACCCAGGAGG + Intergenic
921825158 1:219664170-219664192 GAGAATTGTCTGAACCCAGGAGG + Intergenic
923207795 1:231775746-231775768 GGCACTTGTTTTAAAGCAGGGGG - Intronic
923864852 1:237928659-237928681 GAGAATTGCTTGAAAACAGGAGG + Intergenic
1062982305 10:1736005-1736027 GCCAGTTGTTTGAAAGCAGGAGG - Intronic
1063166281 10:3465799-3465821 GCCACGTGCATGAAAACAGGAGG - Intergenic
1063555456 10:7074925-7074947 AACACATGGCTGAAAACAGAAGG + Intergenic
1064494761 10:15897477-15897499 TACACATGTCTGCTAACAGGAGG + Intergenic
1064673415 10:17738334-17738356 GACACTTGTTGGAAAGGAGGAGG - Intergenic
1066134715 10:32433463-32433485 GAGACTTGCCTGAACCCAGGAGG + Intergenic
1068382921 10:56282123-56282145 CATTCTTGTCAGAAAACAGGTGG + Intergenic
1068545380 10:58338488-58338510 AAAACATGTCTGAAAAGAGGAGG + Intronic
1069475829 10:68731683-68731705 GGCACTTGTTTGAACCCAGGAGG - Intronic
1069711542 10:70492544-70492566 GAGAATTGTCTGAACCCAGGAGG - Intronic
1070078003 10:73157137-73157159 GATAATTGCCTGAAAACAAGAGG - Intronic
1070824144 10:79381072-79381094 GTCACTGGCCTGAAAGCAGGTGG - Intergenic
1073162636 10:101413231-101413253 GAGAATTGCCTGAACACAGGAGG - Intronic
1074655313 10:115581144-115581166 GACACTAGTCTGATAACACAGGG - Intronic
1076232834 10:128835912-128835934 GACACATCTCAGAGAACAGGAGG + Intergenic
1077535005 11:3119786-3119808 GACACTTGGCTGCAGAGAGGCGG + Intronic
1077774569 11:5256906-5256928 GGAAGTTGTTTGAAAACAGGAGG - Intronic
1078172137 11:8936217-8936239 GAGAATTGTTTGAACACAGGAGG + Intergenic
1078341420 11:10500130-10500152 GGCTCTTGTCGGAAAACATGTGG - Exonic
1080366776 11:31583156-31583178 AACAGTTGTGTGAAAACAGAAGG - Intronic
1083198213 11:61103402-61103424 GACTCTGGGCTGGAAACAGGAGG + Intronic
1083614968 11:64021739-64021761 CACACTTGTCAGAGAACAGAAGG - Intronic
1083637596 11:64128844-64128866 GGCACTTGTCTGGCACCAGGAGG + Intronic
1083797503 11:65025878-65025900 GAGAATTGCCTGAAACCAGGAGG - Intronic
1084587021 11:70068236-70068258 GACACTTGCCTCTTAACAGGAGG - Intergenic
1085207187 11:74742631-74742653 GAGACTTGTTTGAACCCAGGAGG + Intergenic
1085420454 11:76353917-76353939 GACAATTGCCTGAACCCAGGAGG + Intronic
1089316555 11:117595108-117595130 GACACTTCTCTGAAGAGATGAGG + Intronic
1090063937 11:123487692-123487714 GACACTTGCTTGAACCCAGGAGG - Intergenic
1091499731 12:1004494-1004516 GAGAATTGTCTGAACCCAGGAGG - Intronic
1091884144 12:4003628-4003650 TTTACTTGTCTGAAGACAGGAGG - Intergenic
1095776285 12:46013544-46013566 GAGACTTGCTTGAACACAGGAGG - Intergenic
1096381522 12:51162354-51162376 GAGACTTGCCTGAACCCAGGAGG + Intronic
1098953731 12:76667749-76667771 GAGAATTGTCTGAACCCAGGAGG - Intergenic
1099275888 12:80575747-80575769 GACAATTGGTTGAAATCAGGAGG + Intronic
1099957984 12:89369828-89369850 GACACATGCCTTAAAAAAGGAGG - Intergenic
1101557421 12:105823382-105823404 GACAATTGCTTGAAATCAGGAGG - Intergenic
1101567647 12:105923254-105923276 GAGCCTAGGCTGAAAACAGGGGG + Intergenic
1102741521 12:115211563-115211585 GACACTTATCAGTAAACAGGAGG - Intergenic
1103822107 12:123707334-123707356 GAGAGTTGTCTGAACCCAGGAGG - Intronic
1104037532 12:125107871-125107893 GACAATTGCCTGAACCCAGGGGG + Intronic
1105832041 13:24171314-24171336 GACCCTTGTCTCAGAACATGCGG + Intronic
1108639041 13:52364936-52364958 GAAAGTGGTATGAAAACAGGAGG + Intergenic
1108650903 13:52478624-52478646 GAAAGTGGTATGAAAACAGGAGG - Intergenic
1109043894 13:57381553-57381575 GAATCTTCTCTGAAAACAGTGGG - Intergenic
1110686215 13:78377788-78377810 GACACTTTTCTGAGTACATGCGG - Intergenic
1111241373 13:85480398-85480420 GAGAATTGTCTGAACCCAGGAGG - Intergenic
1113198290 13:107835433-107835455 GCCACTCCTCTGAAAGCAGGAGG + Intronic
1114213287 14:20634140-20634162 GAGAATTGTTTGAAACCAGGAGG + Intergenic
1114533384 14:23408927-23408949 AACACTTGTCTGAAGACTTGGGG - Intergenic
1115103071 14:29726527-29726549 GACACTTATGTCAATACAGGTGG + Intronic
1115468355 14:33741110-33741132 CACACTTGTCTGGGAGCAGGAGG - Intronic
1116661059 14:47710800-47710822 GACACTATTCTGAAAAAATGTGG + Intergenic
1117673784 14:58134865-58134887 GACAATTGCCTGAACCCAGGAGG + Intronic
1117777560 14:59198293-59198315 GAGAATTGTTTGAACACAGGAGG - Intronic
1119651110 14:76383863-76383885 GAAATTTGTCTGTAAACAGCAGG - Intronic
1119718616 14:76876116-76876138 GACACAGGTCAGAAAGCAGGAGG - Intergenic
1120068264 14:80071641-80071663 GAAACTTGTAAGAAAACACGAGG + Intergenic
1120144919 14:80969053-80969075 TACACATGTCTGAAAACCCGGGG - Intronic
1120639043 14:86987339-86987361 GACAATTGTCTGAACCCGGGAGG + Intergenic
1121550690 14:94797412-94797434 GAGACTTGTTTGAAATCAGGAGG - Intergenic
1125727607 15:41876029-41876051 GACTCTTCCATGAAAACAGGTGG + Intronic
1126098569 15:45106259-45106281 GACACCTGTCTGACAGCAGCTGG + Exonic
1128914095 15:71543936-71543958 GAGAATTGTTTGAACACAGGAGG + Intronic
1131198033 15:90372729-90372751 GAGAATTGCCTGAATACAGGAGG - Intergenic
1132330785 15:101011120-101011142 GACTCATGCCTGAAAAAAGGAGG + Intronic
1134478800 16:14599341-14599363 GAGGCCTTTCTGAAAACAGGCGG - Intronic
1134895873 16:17886336-17886358 GACAGTTCTCTAGAAACAGGAGG - Intergenic
1136390063 16:29958395-29958417 GACAATTGTTTGAACTCAGGAGG + Intronic
1137523937 16:49217337-49217359 GACACCTGTTTGCAAAGAGGAGG - Intergenic
1140077468 16:71715033-71715055 GACACGTTTCTGAAAACACAAGG - Intronic
1140869159 16:79090881-79090903 GACAATTGTTTGAACCCAGGAGG - Intronic
1145177533 17:20713887-20713909 GAGACTTGCCTGAACCCAGGAGG - Intergenic
1146375555 17:32291589-32291611 GAGACTTGCCTGAACTCAGGAGG + Intronic
1147893229 17:43732317-43732339 AACCCTTGTCTTAAACCAGGAGG - Intergenic
1148908520 17:50927091-50927113 GAGAATTGTATGAAACCAGGAGG - Intergenic
1149439730 17:56664140-56664162 GAAACTTGGCCAAAAACAGGTGG + Intergenic
1150240623 17:63629210-63629232 GAGAATTGCCTGAACACAGGAGG - Intronic
1151782873 17:76258956-76258978 GACACTTGGCTGGACACAGGAGG - Intergenic
1153626485 18:7026249-7026271 GATATTAATCTGAAAACAGGAGG - Intronic
1155422460 18:25669820-25669842 GACACGTTTCTTAAAACAAGAGG - Intergenic
1156685632 18:39641988-39642010 GAGACTTGCTTGAATACAGGAGG + Intergenic
1158980835 18:62759967-62759989 GACACAGGTCTGAGAACAGCCGG - Intronic
1158994187 18:62900205-62900227 GAGACTTGTTTGAACCCAGGAGG + Intronic
1162832891 19:13298218-13298240 GAGAATCGCCTGAAAACAGGGGG - Intronic
1162868484 19:13567338-13567360 GAGAATTGTTTGAACACAGGAGG + Intronic
1162894336 19:13756107-13756129 GACACTTGTCCCAAAGCAGTGGG + Intronic
1164291663 19:23874954-23874976 GACAATTGCTTGAAACCAGGAGG - Intergenic
1164655854 19:29921232-29921254 GAAACTTGTCTGCAAACAGCTGG - Intergenic
1164961306 19:32433109-32433131 GAGTATTGTCTGAGAACAGGAGG + Intronic
1165344340 19:35234777-35234799 GACACTTATTTGAAACCAGAAGG - Intergenic
1165541552 19:36496345-36496367 GAGAATTGTTTGAACACAGGAGG - Intergenic
1165814628 19:38634184-38634206 GAGAATTGTTTGAAACCAGGAGG - Intronic
924964486 2:62588-62610 GACAATTGTTTGAACCCAGGAGG + Intergenic
925786755 2:7438738-7438760 GAGACTTGTTTGAACCCAGGAGG + Intergenic
927118633 2:19930392-19930414 GACACTGCACTGAAGACAGGTGG - Exonic
928819640 2:35344053-35344075 GACACTTTTCTGTAGACATGAGG + Intergenic
929021893 2:37561632-37561654 AAAACTTGTTTAAAAACAGGAGG + Intergenic
929488308 2:42374362-42374384 GACACTTCTGTGAAAAAAGTAGG - Intronic
930948402 2:57105913-57105935 GCCACTAATCTGACAACAGGTGG - Intergenic
931084640 2:58815623-58815645 GTCAGGTGTCTGAAAAAAGGAGG + Intergenic
931101696 2:59009391-59009413 GACAATGGTCTGAAAACTGTAGG + Intergenic
932262980 2:70342510-70342532 GACAATTGCTTGAACACAGGAGG + Intergenic
932933647 2:76075379-76075401 GCCACAAGTCTGAAAACAGCAGG - Intergenic
933934478 2:87190722-87190744 GACACTTGCTTGAACCCAGGAGG - Intergenic
934961566 2:98680131-98680153 GAGAATTGTCTGAATCCAGGGGG - Intronic
935144127 2:100382693-100382715 GATAATTGTCTGAACCCAGGAGG - Intergenic
936107722 2:109639798-109639820 GAGACTTGTCTGAACCCAGGAGG - Intergenic
939157751 2:138544882-138544904 AACACATGCTTGAAAACAGGTGG - Intronic
939318995 2:140591168-140591190 GACATTTTTCTGAACTCAGGAGG - Intronic
942935384 2:181550230-181550252 GACATTTGTCAGATAACAGAGGG - Intronic
943937900 2:193947202-193947224 GACACTTTGCTGAGAAAAGGCGG - Intergenic
944691073 2:202159060-202159082 GGGACTGGTCTCAAAACAGGTGG - Intronic
945781996 2:214186847-214186869 GACAATTGCTTGAACACAGGGGG - Intronic
1169708006 20:8528809-8528831 GACCCTTTTATGAAAACAAGGGG + Intronic
1171235056 20:23517954-23517976 ATCAGTTGTCTGAAAACAGTTGG - Intergenic
1173459849 20:43234407-43234429 GAGACTTGTTTGAACACAGGAGG - Intergenic
1174083922 20:47991556-47991578 GCCAATTGTCAGAAAATAGGTGG - Intergenic
1178085469 21:29107223-29107245 GAGAATTGCCTGAACACAGGAGG + Intronic
1178666467 21:34551470-34551492 GACAATTGAGGGAAAACAGGAGG + Intronic
1180420368 22:12808736-12808758 GAGAATTGTTTGAAACCAGGAGG + Intergenic
1181490772 22:23259604-23259626 GAGAATTGCCTGAACACAGGAGG - Intronic
1183349328 22:37325855-37325877 GAAACTTGTTTGAACCCAGGAGG - Intergenic
1184685291 22:46094068-46094090 GTCAGTTGTATGAAAAGAGGTGG + Intronic
1203294884 22_KI270736v1_random:32464-32486 GACAATTGTTTGAACCCAGGAGG + Intergenic
949248610 3:1955867-1955889 GGTACTTGTTTCAAAACAGGAGG - Intergenic
952311817 3:32197369-32197391 GATAATTGCTTGAAAACAGGAGG + Intergenic
953190896 3:40687026-40687048 GACACATGGCTACAAACAGGTGG - Intergenic
953465139 3:43113141-43113163 GAGAATTGCTTGAAAACAGGAGG + Intergenic
953718195 3:45333706-45333728 GACACTTCTCTGACAACAGGGGG - Intergenic
955513777 3:59707064-59707086 GAGAATTGTTTGAACACAGGGGG - Intergenic
957432398 3:80128229-80128251 GACAGTTGTCAGAAACAAGGAGG - Intergenic
957870577 3:86085970-86085992 GACATATGTCTGAAAATAGAAGG + Intergenic
958657678 3:97023166-97023188 GAGAATTGCTTGAAAACAGGAGG - Intronic
958674489 3:97250954-97250976 GAGAATTGTCTGAACCCAGGAGG - Intronic
962140334 3:132783744-132783766 GACAGGTGTCTGGAATCAGGAGG - Intergenic
963625267 3:147663895-147663917 AAAACTTGTTTCAAAACAGGTGG + Intergenic
966047898 3:175575372-175575394 GAGACTTGTTTGAACCCAGGAGG - Intronic
966152327 3:176878001-176878023 TCCACTTGTTGGAAAACAGGGGG - Intergenic
969357682 4:6640152-6640174 GACAATCGTTTGAAAACGGGAGG - Exonic
973174376 4:47186437-47186459 GAAATTTGTCTGAAAACATTAGG + Intronic
974669454 4:65010091-65010113 GAAAATCGTCTGAACACAGGAGG + Intergenic
974875292 4:67697093-67697115 GAAAATCGTCTGAAACCAGGAGG - Intronic
975661775 4:76695917-76695939 GACACTGGACTGAAACCAGATGG + Intronic
975912965 4:79290577-79290599 GAAACTCGTTTGAAAACAGTAGG + Intronic
976180657 4:82395792-82395814 GACTCTAGGCGGAAAACAGGTGG + Intergenic
980949909 4:139365125-139365147 GACAATTGCTTGAAACCAGGAGG - Intronic
981226276 4:142298283-142298305 TAGACCTGTCTGAAAACGGGAGG + Intronic
982089056 4:151864682-151864704 GAGAGTTGTCTGAAGTCAGGGGG + Intergenic
982204933 4:152990492-152990514 GACACATGTCAGAAAAATGGTGG + Intergenic
982342865 4:154321970-154321992 GACACTTGTATGTAAACAAATGG - Intronic
983880804 4:172930186-172930208 GAGAATTGCCTGAACACAGGAGG + Intronic
984548612 4:181134605-181134627 GAGAATTGTTTGAACACAGGAGG + Intergenic
986729086 5:10621996-10622018 GACAGCTGCCTGCAAACAGGAGG + Intronic
986819882 5:11454684-11454706 GAGACTTGCTTGAAACCAGGAGG - Intronic
987309174 5:16666433-16666455 GACACATGCCTTAAAAAAGGAGG - Exonic
987933106 5:24427812-24427834 AACACTGGTCTGAAAAGAGTAGG - Intergenic
992632457 5:78695329-78695351 GACAATTGCTTGAAACCAGGAGG - Intronic
992758703 5:79932928-79932950 GACACTTGCCTGAAAACAAGTGG - Intergenic
993806539 5:92417584-92417606 GAGAATTGTCTGAACCCAGGAGG - Intergenic
997768432 5:136528379-136528401 AACCGTTATCTGAAAACAGGAGG - Intergenic
998492456 5:142559054-142559076 GACAATTGTTTGAACCCAGGAGG - Intergenic
998601950 5:143593556-143593578 GAAAAGTGCCTGAAAACAGGAGG - Intergenic
999402265 5:151274362-151274384 GAGAATTGTTTGAACACAGGAGG - Intergenic
1000494941 5:161970826-161970848 GAGACTTGCTTGAAACCAGGAGG - Intergenic
1000999472 5:167992169-167992191 GACACTGCTCTGATGACAGGTGG + Intronic
1002719568 5:181249918-181249940 GAGAATTGTCTGAACCCAGGAGG - Intergenic
1002900761 6:1407831-1407853 GTCACTTGACTGTAAACACGTGG - Intergenic
1003855805 6:10273371-10273393 GACATTTTCCTTAAAACAGGAGG + Intergenic
1004913398 6:20308306-20308328 GACAGTTGTTTTGAAACAGGAGG + Intergenic
1005063963 6:21800254-21800276 GACACTTTTTTAAAAACAGGGGG - Intergenic
1006592323 6:35167455-35167477 GCCAGTTGTCTGAAGACAGAGGG - Intergenic
1007744852 6:44037465-44037487 GAGACTTGCTTGAACACAGGAGG - Intergenic
1009669827 6:66732425-66732447 GACAATTGCTTGAACACAGGAGG + Intergenic
1009821561 6:68808817-68808839 GATACTTTTCTGATAACAGCTGG - Intronic
1016216807 6:141613987-141614009 GACTCCTTACTGAAAACAGGTGG - Intergenic
1017449675 6:154542898-154542920 GAAACTTGTCTGCAAAGAGCTGG - Intergenic
1018145871 6:160888115-160888137 GATAATTGTTTGAACACAGGAGG + Intergenic
1019030099 6:169002423-169002445 GACAATTGCTTGAAACCAGGAGG + Intergenic
1019984820 7:4647988-4648010 GAGACTTGCCTGAACCCAGGAGG + Intergenic
1022615705 7:31927549-31927571 GACACCTGTCTGATACCAGCTGG - Intronic
1023449095 7:40263010-40263032 CAGAATCGTCTGAAAACAGGAGG - Intronic
1024159631 7:46661070-46661092 GACACATCAATGAAAACAGGTGG + Intergenic
1027485903 7:78761553-78761575 GAGAATTGTTTGAACACAGGAGG - Intronic
1029133322 7:98350232-98350254 GACTCGTGGTTGAAAACAGGGGG - Intronic
1029193996 7:98791555-98791577 GACACAGCCCTGAAAACAGGAGG + Intergenic
1029966450 7:104745776-104745798 TAAGCTTGTCTGAAAAAAGGGGG + Intronic
1030138024 7:106276750-106276772 GAGAATTGCCTGAAACCAGGAGG + Intronic
1031062627 7:117069287-117069309 GACAATTTTCAGAACACAGGGGG + Intronic
1031716752 7:125117648-125117670 GACACTTGCCTGAACCCAGGGGG + Intergenic
1031763376 7:125742708-125742730 GAGAGTTGTCTCAAAAAAGGAGG + Intergenic
1032600303 7:133286813-133286835 GACACTGCACAGAAAACAGGAGG - Intronic
1034579667 7:152031645-152031667 GACTCGTGTCTGACAACTGGTGG - Intronic
1034760187 7:153665038-153665060 GAGAATTGTCTGAACCCAGGAGG + Intergenic
1035156509 7:156918577-156918599 CACACTTACCTGAAAGCAGGAGG - Intergenic
1036001004 8:4604810-4604832 GATCCTTGGCTGAAAAAAGGAGG - Intronic
1037001087 8:13719476-13719498 GGCACTTGTGTGGAAAAAGGAGG + Intergenic
1038017987 8:23530605-23530627 GACACTGGACTGATACCAGGTGG + Intronic
1038287813 8:26221390-26221412 GAGAATAGTTTGAAAACAGGAGG + Intergenic
1042202421 8:66292035-66292057 TCCACTTGTCTGACAACATGGGG + Intergenic
1043432271 8:80206494-80206516 GACACTGGTCAGGAAGCAGGTGG + Intronic
1043432383 8:80207512-80207534 GACACTGGTCAGGAAGCAGGTGG + Intronic
1043579846 8:81699372-81699394 GAAATTTGTCTGCAAGCAGGTGG + Intergenic
1045755513 8:105536716-105536738 GAGACTTGTATGAAAGCATGGGG + Intronic
1046518742 8:115297423-115297445 GACACTTTTTTGAAATCAGCTGG + Intergenic
1046952785 8:120033975-120033997 GAGACTTGTTTGAACTCAGGAGG + Intronic
1047019200 8:120756763-120756785 GACAATTGGCTTAAAACTGGAGG + Intronic
1047100977 8:121675597-121675619 GAGAATTGTTTGAAACCAGGAGG - Intergenic
1047172153 8:122504121-122504143 GACTCTGCTCTGAAAACAGAGGG + Intergenic
1047646789 8:126878247-126878269 GAGACATGTCTCAAAAGAGGGGG + Intergenic
1050518769 9:6474614-6474636 GAGAATTGCCTGAATACAGGAGG + Intronic
1051300212 9:15642072-15642094 GACAATTGCTTGAAACCAGGAGG + Intronic
1052977766 9:34424241-34424263 GCCACTTGTTTGAAGACATGAGG + Intronic
1053826659 9:42032002-42032024 GAAGCTTGTCTGAGAGCAGGCGG + Intronic
1054320060 9:63650006-63650028 GAGAATTGTCTGAACCCAGGAGG + Intergenic
1054603900 9:67155421-67155443 GAAGCTTGTCTGAGAGCAGGCGG - Intergenic
1054773901 9:69108431-69108453 GAGAATTGTCTGAACCCAGGAGG + Intergenic
1055198831 9:73631256-73631278 GAAACTTTTCCTAAAACAGGGGG - Intergenic
1058981845 9:110177430-110177452 GAGACTTGCCTGAACCCAGGAGG + Intergenic
1061376607 9:130229342-130229364 GAGAATTGTCTGAACCCAGGAGG - Intronic
1062153887 9:135035322-135035344 GAGAATTGTCTGAACCCAGGAGG + Intergenic
1185708730 X:2285102-2285124 GACAATTTTCTGAAGACAGAAGG + Intronic
1186257022 X:7732957-7732979 GAGACTTCTCTGAGAAGAGGAGG - Intergenic
1188024187 X:25191556-25191578 AACACTTTTCTGACAACAGAAGG - Intergenic
1191834848 X:65453630-65453652 GATAATTGTTTGAACACAGGAGG + Intronic
1193747495 X:85299592-85299614 GAGAATGGTGTGAAAACAGGAGG - Intronic
1193927612 X:87507909-87507931 GAGAATTGCCTGAAACCAGGAGG - Intergenic
1194447758 X:94008516-94008538 GAGAATTGCTTGAAAACAGGAGG - Intergenic
1195376241 X:104230863-104230885 GAGAGTTGTTTGAAACCAGGAGG - Intergenic
1195392957 X:104382266-104382288 GAGAATTGTTTGAACACAGGAGG - Intergenic
1200795667 Y:7339039-7339061 GTCTCTTGTCGGAAAAGAGGTGG + Intergenic
1201057293 Y:10008015-10008037 GACAATTGTTTGAACCCAGGAGG - Intergenic
1201578141 Y:15482388-15482410 TAAACGTGTCTAAAAACAGGAGG + Intergenic
1201799041 Y:17934162-17934184 GATAATTGTTTGAAATCAGGAGG + Intergenic
1201802512 Y:17971794-17971816 GATAATTGTTTGAAATCAGGAGG - Intergenic
1202360338 Y:24102686-24102708 GATAATTGTTTGAAATCAGGAGG + Intergenic
1202510439 Y:25567430-25567452 GATAATTGTTTGAAATCAGGAGG - Intergenic