ID: 909634188

View in Genome Browser
Species Human (GRCh38)
Location 1:77796947-77796969
Sequence GGTCAGAGGTGACCACAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 192}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909634188 Original CRISPR GGTCAGAGGTGACCACAAAG GGG (reversed) Intronic
901031181 1:6307846-6307868 GGGCAGAGGGAACCACAAACAGG + Intronic
901031193 1:6307906-6307928 GGGCAGAGGGAACCACAAACAGG + Intronic
902853763 1:19183831-19183853 GGTCAGAGGTTACCAGTGAGTGG + Exonic
904317680 1:29676385-29676407 GGTCAGTGGTGACCAGCATGAGG + Intergenic
907469979 1:54667210-54667232 GGTCAGAGAAGACCACTCAGAGG - Intronic
908088508 1:60662060-60662082 AGGCAGAGGAGACCCCAAAGAGG - Intergenic
909634188 1:77796947-77796969 GGTCAGAGGTGACCACAAAGGGG - Intronic
909754894 1:79213177-79213199 GGGCAGAGAAGAGCACAAAGAGG - Intergenic
910416331 1:87002764-87002786 GGTTGTAGGTGACCAAAAAGGGG - Intronic
911605873 1:99904592-99904614 GGTCAGGTGTGACCATAAAAGGG - Intronic
915501433 1:156321460-156321482 GGTCAAAGATGACCACCAACTGG + Intronic
916640084 1:166718070-166718092 GGTCAGACTGGACCCCAAAGGGG + Intergenic
920225265 1:204433918-204433940 TGTCCGAGGTGAAGACAAAGGGG + Exonic
921308736 1:213822130-213822152 AATCAGAGGAGAGCACAAAGGGG - Intergenic
921699912 1:218257020-218257042 CATCAGAGTTGACCACAGAGGGG + Intergenic
922352388 1:224744791-224744813 GGGCAGAAATGACCACAGAGTGG - Intergenic
922647018 1:227297757-227297779 GATCAGAAGTTACCACAAACTGG + Intronic
924473423 1:244363474-244363496 GGTCAGTGGGGAACAGAAAGGGG + Intronic
1063969649 10:11372688-11372710 GATCAAAGGTGCCCACAAAGAGG - Intergenic
1066500459 10:35988572-35988594 GGTCAGAGGTGCTCAAAAAGGGG + Intergenic
1066628350 10:37432803-37432825 GGTCAGAGGTGCCCCAAAAGGGG + Intergenic
1068221774 10:54054488-54054510 GGTCATTTGTGACCATAAAGTGG + Intronic
1071834029 10:89401507-89401529 TGACAGATGTGACCATAAAGGGG + Intronic
1072787866 10:98296393-98296415 GGAGAGAGGTGAGCACCAAGGGG - Intergenic
1075212073 10:120499944-120499966 GGACAGAGGTGGGCACATAGTGG - Intronic
1075601496 10:123772651-123772673 GGGGAGTGATGACCACAAAGAGG - Intronic
1076130634 10:128011511-128011533 TGCCAGAGGTGACCAGAAGGTGG - Intronic
1077724573 11:4661388-4661410 GGTTGGAGATGGCCACAAAGTGG + Intergenic
1078079877 11:8196280-8196302 GGGAAGAGGTGACCAGAGAGTGG + Intergenic
1079377560 11:19907184-19907206 AGTCAGAAATGACTACAAAGGGG + Intronic
1081723306 11:45305818-45305840 GGGAAGAGGTGATTACAAAGGGG - Intergenic
1082652574 11:55811829-55811851 GGTTACAGATGGCCACAAAGCGG - Exonic
1082653798 11:55827581-55827603 GGTTACAGATGGCCACAAAGCGG - Exonic
1089461104 11:118654298-118654320 GGTCAGAGGTGGCAGGAAAGGGG - Intronic
1092968032 12:13664082-13664104 GGGCAGAGGTGACCAAAATATGG + Intronic
1093390419 12:18612346-18612368 GGTTAAAAGTGACAACAAAGAGG - Intronic
1094793751 12:33945808-33945830 AGTGAGAGGTGACCAGAAATGGG - Intergenic
1095967108 12:47876119-47876141 GTTCACAAATGACCACAAAGGGG + Intronic
1096651752 12:53065310-53065332 GGACAGAGATGACCAAAGAGAGG + Exonic
1097448145 12:59700741-59700763 GGTCAGAGAGGAACACACAGAGG + Intronic
1098378767 12:69845418-69845440 GGTCAGAAATGACCTCATAGTGG - Intronic
1098841834 12:75486808-75486830 GGTGGGGGTTGACCACAAAGGGG + Intronic
1100784520 12:98064949-98064971 GGTCATACCTGACCTCAAAGGGG - Intergenic
1102733066 12:115131479-115131501 GGCCAAATGTGACCACAAAAAGG - Intergenic
1102871339 12:116416502-116416524 TGTCAGAGCTGACCACAAAAGGG - Intergenic
1104033905 12:125085091-125085113 GGTCAGGGATGACTATAAAGGGG + Intronic
1105208946 13:18246708-18246730 GGTGAGAGGTGAGCACAGAGGGG + Intergenic
1106380487 13:29233286-29233308 GGACATAGGTGACCAAAAAGTGG + Intronic
1108684802 13:52809485-52809507 GGCCCCAGGTGACCACAAGGTGG - Intergenic
1110260098 13:73475151-73475173 GGTCAAAGATGACCACACAGAGG + Intergenic
1112136374 13:96583076-96583098 GGGCAAAGGTGAAAACAAAGGGG - Intronic
1112361174 13:98719896-98719918 GGTCAGAGGTTGCCAAACAGTGG - Intronic
1113796896 13:113063584-113063606 AGTCAGACGGGACCACAAAATGG + Intronic
1118339879 14:64885676-64885698 GGACATAGGTGCACACAAAGTGG - Intergenic
1118775331 14:68970291-68970313 GGTCAGAGATCAGCACCAAGTGG - Intronic
1119307065 14:73616030-73616052 GATCACAGGTCACCACAAACTGG + Intronic
1120850203 14:89162887-89162909 GGTCAGCGGAGACCCCAAGGAGG - Exonic
1121357147 14:93224808-93224830 GTTCAGAGGTTACCACACTGAGG - Intronic
1122987555 14:105219518-105219540 GGCCACAGGTTCCCACAAAGGGG + Intronic
1124356276 15:28997085-28997107 GGTGAGTGGTTACCACAATGTGG - Intronic
1129707523 15:77803139-77803161 GGACAGAGGTGAGCACAGGGTGG - Intronic
1130996773 15:88908538-88908560 AGGCAGGGGTGACCACACAGCGG - Intronic
1131018534 15:89078065-89078087 GGTCAGAGATGATCCCAAGGTGG - Intergenic
1131528179 15:93169114-93169136 GGTCACATGTGGTCACAAAGGGG + Intergenic
1131867141 15:96723084-96723106 GGTCAGATGTGATCACCCAGCGG + Intergenic
1131872835 15:96779091-96779113 GGTCCGAGATGACCTGAAAGTGG + Intergenic
1133530960 16:6654327-6654349 GATCAGAGGTCACAGCAAAGAGG - Intronic
1133999006 16:10768125-10768147 GGTCTGTGATGACCACAGAGTGG + Exonic
1134834049 16:17346600-17346622 GGTCAGAGATGGCCACGAGGAGG + Intronic
1136847600 16:33589062-33589084 GGGCTGAGGTGCCCACAGAGGGG - Intergenic
1138273131 16:55710309-55710331 GGTCAAAGGCGACTACAAGGAGG - Intergenic
1138549723 16:57740770-57740792 GGTGAGGGCTGACCACACAGAGG - Intronic
1141514498 16:84534845-84534867 AGTCAGCGGTGACCATACAGGGG - Intronic
1141579011 16:84984575-84984597 GGTCATAAGTGACCAAAAACTGG - Intronic
1141999189 16:87654469-87654491 GGTCTGACCTAACCACAAAGAGG - Intronic
1203109308 16_KI270728v1_random:1437717-1437739 GGGCTGAGGTGCCCACAGAGGGG - Intergenic
1142717582 17:1755434-1755456 GGTCAGAGGGGACCACGGGGTGG - Intergenic
1143791211 17:9297424-9297446 GGCCAGAGGTGGCAACAAAATGG + Intronic
1146274618 17:31508825-31508847 CGTCAGAGGAGCCCACAGAGAGG - Intronic
1146624255 17:34423983-34424005 GGGCAGAGGTGACCACTTATTGG + Intergenic
1149782780 17:59411223-59411245 GGAGAGAGGTGATTACAAAGGGG - Intergenic
1151241383 17:72760935-72760957 GGGCAGTAGTGCCCACAAAGGGG - Intronic
1151558184 17:74857611-74857633 GGGCAGAGGTGAGCAGACAGAGG - Intronic
1151571397 17:74927634-74927656 GGTCAGGGGTGGGGACAAAGAGG - Intronic
1152247000 17:79190085-79190107 GGAAAGAGGTGACCTCAAACAGG - Intronic
1152974496 18:201242-201264 GGTTAGAGGAGACAGCAAAGAGG - Intronic
1154164609 18:12005208-12005230 GGGCAGAGGTGTACACAAGGTGG + Intronic
1156378322 18:36534042-36534064 GGTCAGAAGTGTCCACAAACAGG - Intronic
1156849268 18:41707389-41707411 GATCAGAGGTGACCATAATGTGG + Intergenic
1157744866 18:50126464-50126486 AATCACAGGGGACCACAAAGTGG + Intronic
1158305041 18:56095934-56095956 GGTCAGAAGTGAACAGACAGTGG + Intergenic
1160422568 18:78757177-78757199 GGTCAGACCTGGCCACATAGTGG + Intergenic
1160812312 19:1018104-1018126 GGACCCAGGTGACCACCAAGTGG - Intronic
1160834158 19:1116754-1116776 GGCCACAGGTGGCCACAGAGAGG + Intronic
1161141455 19:2650653-2650675 GGTCAGAGGCGAGCACAGCGTGG + Intronic
1161293757 19:3509058-3509080 GGTCACTGGTGACCACAGGGAGG - Intronic
1162215762 19:9132581-9132603 GGTCAGACGTGAGCACAAAGGGG + Intergenic
1162739850 19:12767689-12767711 GGCTGGAGGTGACCAGAAAGAGG - Intronic
1163075462 19:14887037-14887059 GGTGACAGATGGCCACAAAGTGG + Intergenic
1163717611 19:18881022-18881044 GGTCAGAGGTCACCAAGATGAGG - Intronic
1163746554 19:19052239-19052261 GGTCAGATGTGACCAGAGTGAGG + Intronic
1163768838 19:19178617-19178639 GGTCACTGATGACCCCAAAGAGG + Intronic
1167397012 19:49236381-49236403 GGTCAGAGATGAGCACCTAGAGG + Intergenic
1167591464 19:50406658-50406680 GGTCAGAGGTCAGGAAAAAGTGG - Intronic
1168597380 19:57689113-57689135 GGTCAGAGGTCACCATGAAAAGG + Exonic
1168661759 19:58172855-58172877 GGACAGATGTGACCACACATAGG - Intergenic
925146643 2:1587123-1587145 GGGCAGAGATGACCACAGGGAGG - Intergenic
927295244 2:21445939-21445961 GCTCAGAGGTAAGAACAAAGTGG - Intergenic
927433532 2:23047564-23047586 GGTCAGAGGTCCCAGCAAAGTGG + Intergenic
928197398 2:29225503-29225525 GGGCAGAGGTCACCACAGAGAGG + Exonic
928499555 2:31875985-31876007 GGTCAGAGGTAGCAACAATGGGG - Intronic
930608740 2:53518359-53518381 CTTCAGAGGTGACCCCACAGTGG - Intergenic
930906941 2:56581048-56581070 GGTGAGAGGGGAGGACAAAGAGG + Intergenic
931171383 2:59807268-59807290 GGTGAGAGGTGAGCAGAAAGAGG - Intergenic
933207879 2:79530056-79530078 CTTCAGAGCAGACCACAAAGTGG - Intronic
933901837 2:86855787-86855809 GGTCAGTGGTGAGCCCAGAGGGG + Intronic
934070181 2:88376760-88376782 GCTCAGAGGTCACCACAATAGGG - Intergenic
935778709 2:106493476-106493498 GGTCAGTGGTGAGCCCAGAGGGG - Intergenic
939826248 2:147018884-147018906 GCTCAGAGGTGACCACAGCAGGG - Intergenic
942328176 2:174793455-174793477 TGTCAAAGGTGTCCTCAAAGGGG - Intergenic
944563686 2:200966101-200966123 AGTCAGAGGGGACCATAAAATGG + Intergenic
946175241 2:217918557-217918579 GGTCAGAGGTTAGGACAAAAGGG - Intronic
948605829 2:239134230-239134252 CGTCACAGGTGAGCACAAATGGG - Exonic
948840827 2:240648074-240648096 GGGCAGAGGTGGCCAGAGAGGGG + Intergenic
948889143 2:240898327-240898349 GGGCAGCTTTGACCACAAAGGGG + Intergenic
1169260037 20:4130774-4130796 GGGAAGAGGTGATCACACAGGGG + Intronic
1169276243 20:4235460-4235482 GTTAAGAAGTGACAACAAAGAGG - Intronic
1170212261 20:13857423-13857445 GATCAGTGGTGACTCCAAAGAGG + Intronic
1170581044 20:17699881-17699903 GGTCGGGGGTGAGCACAAAAAGG - Intronic
1171290122 20:23978440-23978462 GGTGAGAGGTGAGCACAAAGGGG + Intergenic
1172756442 20:37288426-37288448 GGTGGGAGGTGACTACAGAGGGG + Intergenic
1173251084 20:41364616-41364638 GGACTGTGGTGACCACAAGGAGG - Intronic
1173318979 20:41970646-41970668 GCTCAGAGGAGACCAGAGAGGGG - Intergenic
1173333268 20:42093204-42093226 GGTCCGTAGAGACCACAAAGAGG + Intronic
1173637884 20:44576932-44576954 GTCCAAAGGGGACCACAAAGTGG + Intronic
1174444613 20:50582249-50582271 GGTCAGAGGTCACCACAGGGTGG + Intronic
1174514877 20:51083931-51083953 GGTGAGAGGTGACCACAGCTTGG + Intergenic
1179141297 21:38727730-38727752 GGTAAGAGCTGACGTCAAAGAGG - Intergenic
1180611371 22:17100372-17100394 GGTCAGGGTCAACCACAAAGTGG - Exonic
1180767312 22:18352590-18352612 GGTGAGAGGTGAGCACAGAGGGG - Intergenic
1180778997 22:18509789-18509811 GGTGAGAGGTGAGCACAGAGGGG + Intergenic
1180811718 22:18767109-18767131 GGTGAGAGGTGAGCACAGAGGGG + Intergenic
1181197871 22:21201351-21201373 GGTGAGAGGTGAGCACAGAGGGG + Intergenic
1181401874 22:22654455-22654477 GGTGAGAGGTGAGCACAAAGGGG - Intergenic
1181647678 22:24242647-24242669 GGTGAGAGGTGAGCACAGAGGGG + Intronic
1181703828 22:24635549-24635571 GGTGAGAGGTGAGCACAGAGGGG - Intergenic
1182615434 22:31585859-31585881 TGCCAGAGATGACCAAAAAGGGG - Intronic
1183495205 22:38139318-38139340 GGAAAGAGGAGACCCCAAAGAGG + Intronic
1203228934 22_KI270731v1_random:93484-93506 GGTGAGAGGTGAGCACAGAGGGG - Intergenic
950098462 3:10343547-10343569 GGACAGTGGTGACCTAAAAGTGG - Intronic
950969319 3:17170432-17170454 GGGCAGAGGCCAGCACAAAGGGG + Intronic
951441622 3:22730157-22730179 CCACAGAGGTGACCACAAGGTGG + Intergenic
954332628 3:49899004-49899026 GGTCAGATGTGAGCAAAATGGGG + Intronic
954416751 3:50397028-50397050 GGTCAGAGCTGAGCCCTAAGAGG - Intronic
955220633 3:57020322-57020344 GGACAGTGAAGACCACAAAGGGG + Intronic
959868485 3:111299829-111299851 GGTCAGTGGTAGCCACATAGAGG - Intronic
960452276 3:117825251-117825273 GGGAAGAGTTGATCACAAAGGGG + Intergenic
961256691 3:125560462-125560484 GGATACATGTGACCACAAAGAGG - Exonic
961807138 3:129497492-129497514 GGCCACACGTGACCACAGAGTGG + Intronic
962380514 3:134894773-134894795 GATCAGAGGTGACCACGAGGAGG - Intronic
962815340 3:138992484-138992506 AGTCAGAGGGGACAACAAAGAGG - Intergenic
968222123 3:196947321-196947343 TGCCAGGGGTTACCACAAAGAGG + Exonic
972408236 4:38766483-38766505 GGTCAGAGGTCATCTCAAAGGGG + Intergenic
976317460 4:83673778-83673800 GGTCAGAGGAGGCTTCAAAGAGG - Intergenic
981640315 4:146934860-146934882 GGTCATGGGTGACCCTAAAGAGG + Intronic
982807501 4:159784679-159784701 GGTGAGAGATGACAGCAAAGAGG - Intergenic
985674320 5:1223002-1223024 GGTCAAAGGTCAACACCAAGGGG - Exonic
985681583 5:1258531-1258553 GGTCAGAGGTGAGCAGAGCGCGG + Intronic
986495017 5:8332857-8332879 GGTCAGCGGTGAACACAAGGTGG + Intergenic
986573454 5:9188997-9189019 GGACAGATGTGACCACTGAGTGG - Intronic
990199917 5:53360178-53360200 GGCAACAGGTGACCCCAAAGAGG + Intergenic
990660530 5:58009315-58009337 GGTCATAGGGGAGCACAACGTGG - Intergenic
996092179 5:119362148-119362170 GGACAGAAGTGACTTCAAAGAGG + Intronic
997650030 5:135510171-135510193 GGGCGGAGGTGATCACAGAGAGG - Intergenic
1001315390 5:170638003-170638025 AGTGAGAGGTGCCCAAAAAGGGG + Intronic
1002254771 5:177950983-177951005 GGACAGAGGTAAACACTAAGCGG - Intergenic
1003179172 6:3777459-3777481 GGTCAGAGGTGTCAGCATAGTGG - Intergenic
1006421644 6:33938185-33938207 GATCGGAGGGGACCAAAAAGAGG - Intergenic
1010917428 6:81637610-81637632 GGTGAGAGGAGACCACACATAGG + Intronic
1013174084 6:107662544-107662566 GGGCAGAGGTCAGCACAGAGGGG - Intergenic
1014885135 6:126771239-126771261 GGTCAGAGTTCTCCAAAAAGTGG + Intergenic
1015414453 6:132932885-132932907 TGTCAGAGGTGACCACGCAGAGG + Intergenic
1016630214 6:146220965-146220987 GGTGAGAGACGACCACAGAGAGG + Intronic
1018494331 6:164333575-164333597 AGCCCAAGGTGACCACAAAGAGG + Intergenic
1019200132 6:170307134-170307156 GGTCAGAGGTGACCTCAAGATGG - Intronic
1019482186 7:1272021-1272043 GGTCAGGAGTGGCCACAAAGGGG + Intergenic
1020029515 7:4923022-4923044 GGTCAGAGGAGATCATAAATAGG + Intronic
1021613885 7:22482759-22482781 TGTCAGAGCTGACCCCAGAGAGG - Intronic
1023493630 7:40770487-40770509 GGTTAGAGGAAAGCACAAAGAGG + Intronic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1028447916 7:90945869-90945891 AGTCATAGCTGACCCCAAAGAGG + Intronic
1029737638 7:102473522-102473544 GGTGAGGGGTGGCCACAAGGCGG + Exonic
1031084845 7:117292210-117292232 GGGGTGAGGTGCCCACAAAGAGG - Intronic
1031784881 7:126016909-126016931 GATATGTGGTGACCACAAAGAGG + Intergenic
1032210497 7:129909905-129909927 GGTCTGAGGGGAAAACAAAGGGG + Intronic
1034031202 7:147766073-147766095 AGACAGAATTGACCACAAAGAGG + Intronic
1034775787 7:153825365-153825387 AGTCAGAGGAGACTTCAAAGGGG - Intergenic
1038138122 8:24812879-24812901 AGTCAGAGATGAACAGAAAGTGG - Intergenic
1043483535 8:80676589-80676611 GGTCAGAACTGATGACAAAGAGG + Intronic
1043988534 8:86723067-86723089 GGGCAGAAGTGAACACCAAGAGG - Intronic
1044208508 8:89521183-89521205 AGTCAGAGCTGAACTCAAAGAGG + Intergenic
1044622217 8:94201735-94201757 GGACAGAGGTGGCCTCACAGGGG + Intronic
1044792788 8:95864932-95864954 GGGAGGAGGTGACCACACAGAGG + Intergenic
1048354359 8:133641296-133641318 GGACAGAGCTGGCCACAAAATGG + Intergenic
1048983156 8:139714162-139714184 GGTCAGAGGAGGCCCCAGAGAGG + Intergenic
1050555132 9:6783262-6783284 GGTCAGTGCTGGCCACAAAGAGG + Intronic
1053287938 9:36861950-36861972 GGCCAGAGGTGTCCACTCAGTGG - Intronic
1055680782 9:78712787-78712809 TGTCTCAGGAGACCACAAAGTGG + Intergenic
1056187987 9:84155119-84155141 GCTCAGAGGTGAACACAATGTGG + Intergenic
1056258930 9:84828265-84828287 TGTTAGAGGTGTGCACAAAGAGG - Intronic
1057720380 9:97527603-97527625 GGTCAGATGCGACTAGAAAGAGG + Intronic
1057919255 9:99083035-99083057 GCCCAGATGTGACAACAAAGAGG - Intergenic
1058191657 9:101924074-101924096 TGTCAGAGGAGACCAAATAGCGG + Intergenic
1059014710 9:110503505-110503527 GATTAGAGGTGATCACAAAAGGG + Intronic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1185876078 X:3703445-3703467 GGTCTAAGGAGACCACACAGAGG - Intronic
1186915282 X:14212513-14212535 GGACAGAGGTGAACAGGAAGGGG - Intergenic
1190473419 X:50805409-50805431 GGACAGAAGACACCACAAAGGGG + Intronic
1190741564 X:53292173-53292195 GGTCAGAAGTGAGGTCAAAGAGG + Intronic
1191183519 X:57586553-57586575 GGTCAGAGGTTACCAGACAGGGG + Intergenic
1191213863 X:57915846-57915868 GGTCAGAGGTTACCAGGCAGGGG - Intergenic
1195650498 X:107278453-107278475 GGACAGATGTTACCAGAAAGGGG + Intergenic
1196141002 X:112263274-112263296 GTTCAGAGGTGATCACCTAGGGG + Intergenic
1200789503 Y:7286977-7286999 GGTCTAAGGAGACCACACAGAGG + Intergenic
1201905431 Y:19081768-19081790 GGTGAGATGTGCTCACAAAGAGG - Intergenic