ID: 909636412

View in Genome Browser
Species Human (GRCh38)
Location 1:77821292-77821314
Sequence CAGTTGTTCTTTTGGACCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909636408_909636412 -6 Left 909636408 1:77821275-77821297 CCTCATTTATTCCTGTGCAGTTG No data
Right 909636412 1:77821292-77821314 CAGTTGTTCTTTTGGACCAAGGG No data
909636406_909636412 4 Left 909636406 1:77821265-77821287 CCACATCTTCCCTCATTTATTCC 0: 1
1: 0
2: 3
3: 57
4: 550
Right 909636412 1:77821292-77821314 CAGTTGTTCTTTTGGACCAAGGG No data
909636405_909636412 12 Left 909636405 1:77821257-77821279 CCATTAAGCCACATCTTCCCTCA 0: 1
1: 0
2: 2
3: 11
4: 249
Right 909636412 1:77821292-77821314 CAGTTGTTCTTTTGGACCAAGGG No data
909636407_909636412 -5 Left 909636407 1:77821274-77821296 CCCTCATTTATTCCTGTGCAGTT 0: 1
1: 0
2: 1
3: 29
4: 283
Right 909636412 1:77821292-77821314 CAGTTGTTCTTTTGGACCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909636412 Original CRISPR CAGTTGTTCTTTTGGACCAA GGG Intronic
No off target data available for this crispr