ID: 909643090

View in Genome Browser
Species Human (GRCh38)
Location 1:77888538-77888560
Sequence GCCTGTTCCCGCATTCCAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 79}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909643090_909643099 27 Left 909643090 1:77888538-77888560 CCGCCTGGAATGCGGGAACAGGC 0: 1
1: 0
2: 0
3: 11
4: 79
Right 909643099 1:77888588-77888610 GCTGCTGGAGACGGCGGCGGCGG 0: 1
1: 1
2: 8
3: 73
4: 661
909643090_909643100 30 Left 909643090 1:77888538-77888560 CCGCCTGGAATGCGGGAACAGGC 0: 1
1: 0
2: 0
3: 11
4: 79
Right 909643100 1:77888591-77888613 GCTGGAGACGGCGGCGGCGGCGG 0: 1
1: 4
2: 53
3: 498
4: 2855
909643090_909643095 12 Left 909643090 1:77888538-77888560 CCGCCTGGAATGCGGGAACAGGC 0: 1
1: 0
2: 0
3: 11
4: 79
Right 909643095 1:77888573-77888595 CTTTTATGGAAACTTGCTGCTGG 0: 1
1: 0
2: 1
3: 12
4: 120
909643090_909643097 21 Left 909643090 1:77888538-77888560 CCGCCTGGAATGCGGGAACAGGC 0: 1
1: 0
2: 0
3: 11
4: 79
Right 909643097 1:77888582-77888604 AAACTTGCTGCTGGAGACGGCGG 0: 1
1: 0
2: 0
3: 22
4: 169
909643090_909643093 -2 Left 909643090 1:77888538-77888560 CCGCCTGGAATGCGGGAACAGGC 0: 1
1: 0
2: 0
3: 11
4: 79
Right 909643093 1:77888559-77888581 GCTGCACACCAGGACTTTTATGG 0: 1
1: 0
2: 0
3: 6
4: 105
909643090_909643098 24 Left 909643090 1:77888538-77888560 CCGCCTGGAATGCGGGAACAGGC 0: 1
1: 0
2: 0
3: 11
4: 79
Right 909643098 1:77888585-77888607 CTTGCTGCTGGAGACGGCGGCGG 0: 1
1: 0
2: 1
3: 13
4: 200
909643090_909643096 18 Left 909643090 1:77888538-77888560 CCGCCTGGAATGCGGGAACAGGC 0: 1
1: 0
2: 0
3: 11
4: 79
Right 909643096 1:77888579-77888601 TGGAAACTTGCTGCTGGAGACGG 0: 1
1: 0
2: 0
3: 26
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909643090 Original CRISPR GCCTGTTCCCGCATTCCAGG CGG (reversed) Intronic