ID: 909643090

View in Genome Browser
Species Human (GRCh38)
Location 1:77888538-77888560
Sequence GCCTGTTCCCGCATTCCAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 79}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909643090_909643095 12 Left 909643090 1:77888538-77888560 CCGCCTGGAATGCGGGAACAGGC 0: 1
1: 0
2: 0
3: 11
4: 79
Right 909643095 1:77888573-77888595 CTTTTATGGAAACTTGCTGCTGG 0: 1
1: 0
2: 1
3: 12
4: 120
909643090_909643097 21 Left 909643090 1:77888538-77888560 CCGCCTGGAATGCGGGAACAGGC 0: 1
1: 0
2: 0
3: 11
4: 79
Right 909643097 1:77888582-77888604 AAACTTGCTGCTGGAGACGGCGG 0: 1
1: 0
2: 0
3: 22
4: 169
909643090_909643099 27 Left 909643090 1:77888538-77888560 CCGCCTGGAATGCGGGAACAGGC 0: 1
1: 0
2: 0
3: 11
4: 79
Right 909643099 1:77888588-77888610 GCTGCTGGAGACGGCGGCGGCGG 0: 1
1: 1
2: 8
3: 73
4: 661
909643090_909643096 18 Left 909643090 1:77888538-77888560 CCGCCTGGAATGCGGGAACAGGC 0: 1
1: 0
2: 0
3: 11
4: 79
Right 909643096 1:77888579-77888601 TGGAAACTTGCTGCTGGAGACGG 0: 1
1: 0
2: 0
3: 26
4: 294
909643090_909643093 -2 Left 909643090 1:77888538-77888560 CCGCCTGGAATGCGGGAACAGGC 0: 1
1: 0
2: 0
3: 11
4: 79
Right 909643093 1:77888559-77888581 GCTGCACACCAGGACTTTTATGG 0: 1
1: 0
2: 0
3: 6
4: 105
909643090_909643098 24 Left 909643090 1:77888538-77888560 CCGCCTGGAATGCGGGAACAGGC 0: 1
1: 0
2: 0
3: 11
4: 79
Right 909643098 1:77888585-77888607 CTTGCTGCTGGAGACGGCGGCGG 0: 1
1: 0
2: 1
3: 13
4: 200
909643090_909643100 30 Left 909643090 1:77888538-77888560 CCGCCTGGAATGCGGGAACAGGC 0: 1
1: 0
2: 0
3: 11
4: 79
Right 909643100 1:77888591-77888613 GCTGGAGACGGCGGCGGCGGCGG 0: 1
1: 4
2: 53
3: 498
4: 2855

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909643090 Original CRISPR GCCTGTTCCCGCATTCCAGG CGG (reversed) Intronic
903959313 1:27046737-27046759 GCCTTTTCCAGGTTTCCAGGGGG - Intergenic
904954555 1:34272086-34272108 GTCTTTTCTGGCATTCCAGGAGG - Intergenic
905170605 1:36107673-36107695 GCCGGTTTCACCATTCCAGGGGG - Intronic
905414288 1:37794035-37794057 GCCTGTCCCCGCAGTGCGGGCGG - Exonic
909643090 1:77888538-77888560 GCCTGTTCCCGCATTCCAGGCGG - Intronic
910264835 1:85327565-85327587 GCCTGGACCTGCATTCAAGGAGG - Intronic
910846728 1:91611581-91611603 GCCTGTTGCAGGATTCCAGCAGG + Intergenic
912497654 1:110101865-110101887 CCATGTTCCAGCATCCCAGGAGG - Intergenic
912796866 1:112698696-112698718 ACCTGTCCCCTCCTTCCAGGTGG + Exonic
917553482 1:176058822-176058844 GCGTGTTACCACATTCCAGAGGG - Intronic
918719497 1:187835697-187835719 GCCTTTTCCAGAATTCCAGATGG - Intergenic
919483095 1:198113345-198113367 ACCTTTTCCCTCCTTCCAGGGGG - Intergenic
919727038 1:200891280-200891302 GCCAGTTTCCGCAGCCCAGGCGG - Intronic
1067087421 10:43250270-43250292 CCCCATTCCCCCATTCCAGGTGG - Intronic
1069861441 10:71474151-71474173 GCCTGTTCCCACATGCCACCAGG + Intronic
1070448270 10:76530161-76530183 GACTCTTCCTGCATTCCAGTTGG - Intronic
1070809213 10:79289209-79289231 GCCTGTACCCACATTGCTGGGGG + Intronic
1072183724 10:93014210-93014232 GCCTGTGCCAGGATTCCAGGGGG + Exonic
1077442401 11:2574835-2574857 GCCTCTTCCCGCCTTCCTGGGGG + Intronic
1078266357 11:9758623-9758645 GCCTCTTCCCGCGTTCTCGGCGG + Intergenic
1078924204 11:15859380-15859402 GCCTGTTGCCATATTACAGGGGG + Intergenic
1099428525 12:82553249-82553271 GCCTGTTGCCTCACTCCATGAGG + Intergenic
1099949591 12:89286661-89286683 GCCTGTTCCCTTCTTCCAGATGG + Intergenic
1103314507 12:120041689-120041711 GCCTGTTCCTGCACTCCACTCGG - Intronic
1108979420 13:56491911-56491933 GCCTGTACCCTCATTGCAGATGG - Intergenic
1111979658 13:95002983-95003005 GCCTGTGATCGCTTTCCAGGGGG + Intergenic
1115498892 14:34032132-34032154 GCCTCCTCCCTCAGTCCAGGGGG - Intronic
1118232016 14:63961145-63961167 GTATGTTCCTGCATTCCTGGAGG + Intronic
1124696947 15:31870999-31871021 GCCTTTTCCTGCAGTCCAGGCGG - Intergenic
1127123572 15:55791496-55791518 GCCTGTTCCCCACTTCAAGGTGG + Intergenic
1132758996 16:1499937-1499959 GAGGGGTCCCGCATTCCAGGAGG + Intronic
1134136958 16:11683377-11683399 TCCTTTTCTCGGATTCCAGGAGG - Intronic
1139464730 16:67148427-67148449 GAAGGTTCCCCCATTCCAGGAGG - Exonic
1141427337 16:83952835-83952857 TCCAGTTCCCGCATTCCACCTGG - Intronic
1141685101 16:85565675-85565697 GCCTGTTCTCTCACTCCAGTGGG - Intergenic
1142164300 16:88577534-88577556 GCCAGCTCCCGCCGTCCAGGAGG + Exonic
1142223359 16:88865859-88865881 GCCTGTTGCTGCACTCCTGGAGG + Exonic
1146084130 17:29811821-29811843 GCCTGTCCCAGCATTTCAAGAGG - Intronic
1157727122 18:49973312-49973334 GCCTGTCTCCGCATGCCACGTGG + Intronic
1158497614 18:57970574-57970596 GCCTGTTGCCCAACTCCAGGTGG + Intergenic
1163442381 19:17328548-17328570 GCCGGAGCCCGCAGTCCAGGAGG + Exonic
1164159409 19:22616869-22616891 GCCTGTCCCAGCCCTCCAGGCGG - Intergenic
1164282629 19:23782205-23782227 GCCTGTTCCCTAATCACAGGGGG + Intronic
1167516081 19:49923969-49923991 GCCTTTTCCATCATGCCAGGAGG + Intronic
924995585 2:357690-357712 GCCTTTTCCCCCTTTCCATGTGG - Intergenic
925199972 2:1959337-1959359 GCCTGTCTCCGCTCTCCAGGAGG - Intronic
941140069 2:161768984-161769006 GCCTGCTCGCCCATACCAGGAGG - Intronic
948733153 2:239979941-239979963 ACCTGTTCCTGCCTTCCGGGGGG + Intronic
1168775296 20:442191-442213 GCCTTTTCCTGTATGCCAGGTGG - Intronic
1169400231 20:5273595-5273617 GTCTGTTCTCTCATTCCAGGGGG - Intergenic
1171152854 20:22843068-22843090 GCTTGCTCCCCCAGTCCAGGTGG + Intergenic
1172028848 20:31967960-31967982 CCCTGCTTCCGCATTCCCGGGGG + Intergenic
1173713513 20:45180977-45180999 ACCTGTTCCTGAATTCCAGAAGG - Intergenic
1175424052 20:58853320-58853342 GGCTGTTCCCCGATTTCAGGGGG - Exonic
1178924946 21:36767064-36767086 TCCTCTTCCTCCATTCCAGGCGG + Intronic
1181155425 22:20917276-20917298 GCCCGCTCCCGCGTTCCAGGAGG - Intergenic
1183599379 22:38831110-38831132 GCCTGTTCCCGTTTTAGAGGAGG - Intronic
1184390207 22:44199456-44199478 GCCTGTTCCCCCATTCCCTGAGG + Intronic
954138415 3:48592936-48592958 CCCTGATCCCGCATTCCCAGCGG - Exonic
961454119 3:127015911-127015933 CCCTATCCCCGCATCCCAGGGGG - Intronic
961741681 3:129036919-129036941 GCCTCTCCCAGCCTTCCAGGTGG - Intronic
964435353 3:156645588-156645610 GCTTGTCCCAGCATTCCAGTGGG - Intergenic
967728777 3:192887266-192887288 GCGTGTTCCTGCAGTCCTGGAGG - Intronic
971457588 4:26859224-26859246 GCTTGTTCCTGCTCTCCAGGAGG - Intronic
982871594 4:160585280-160585302 GCCTGTTTCTGCATTCCTGCTGG + Intergenic
986661463 5:10063828-10063850 CCCTGTTCTCCCATTCCTGGGGG - Intergenic
992452254 5:76885410-76885432 CCCTGTTCCCACTTTCCTGGGGG - Intronic
998463224 5:142324484-142324506 GCCCGTTCCAGCGTTCGAGGCGG + Intronic
1003169254 6:3708239-3708261 GGCTGTTCCCGCCATCCAGGTGG + Intergenic
1003586077 6:7390207-7390229 GCCTGTTTCTGCATCCCAGCTGG + Intronic
1007605431 6:43114507-43114529 GGCTGTGCCCCCATTCCAGGGGG - Intronic
1018649266 6:165978113-165978135 GCCATTTCCAGCATTCCAGAAGG - Intronic
1019061150 6:169259211-169259233 TCCTGTGTGCGCATTCCAGGTGG - Intergenic
1019672559 7:2289473-2289495 CCGTCTTCCCTCATTCCAGGAGG + Intronic
1031392646 7:121234498-121234520 GGCTGTTCCTCCATTCTAGGAGG - Intronic
1032274265 7:130440821-130440843 GCCCCTTCCCGCCTTCCGGGCGG + Intronic
1034192857 7:149224732-149224754 GCCTGTTGCCGATTTCCAGACGG - Exonic
1038231032 8:25700528-25700550 GTCTGTTCCATCAGTCCAGGGGG - Intergenic
1038457527 8:27687102-27687124 GCCTGTTCCTGCAATCAAGGTGG - Intergenic
1044565613 8:93658734-93658756 GCCTGTTCACACATTGCTGGAGG + Intergenic
1050019231 9:1266727-1266749 GCCTGTTCCTCCATTCCAGCTGG + Intergenic
1050210281 9:3246364-3246386 GCCTGTGCAAGCATACCAGGAGG + Intronic
1053346723 9:37383571-37383593 GCCTGCTCCCTCTTTCCTGGTGG - Intergenic
1054991045 9:71327349-71327371 GCCTGTTCCAGCATGACAGGTGG - Intronic
1059710200 9:116860750-116860772 GCCTGTTTCCACATTCCTGAGGG + Intronic
1062026153 9:134341707-134341729 GCCTCTTCCCGCCCTCCATGGGG + Intronic
1062460581 9:136661046-136661068 GCTTGTGCCCCCATCCCAGGAGG - Intronic
1186404440 X:9289684-9289706 GACTTTTCCTGCATTTCAGGTGG - Intergenic
1186963454 X:14762096-14762118 GCCTGTTCCCTTCTTCCAAGAGG + Intergenic
1189751263 X:44225300-44225322 GCCTGTCCCTGCATTCCATCAGG + Intronic
1193328373 X:80207995-80208017 GCCTCTTCACAGATTCCAGGTGG + Intergenic