ID: 909647767

View in Genome Browser
Species Human (GRCh38)
Location 1:77936662-77936684
Sequence TAAGCTAGAAGGGATGTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909647767 Original CRISPR TAAGCTAGAAGGGATGTTGC AGG (reversed) Intronic
907118836 1:51991161-51991183 CAAGCAAGAAGTGATGATGCTGG - Intergenic
908678375 1:66631575-66631597 TAATTTTGAAGGGATGTTGGTGG + Intronic
909647767 1:77936662-77936684 TAAGCTAGAAGGGATGTTGCAGG - Intronic
916146795 1:161747046-161747068 TAACCTAGAAGTGAGATTGCTGG + Intergenic
917562388 1:176172993-176173015 TAAGCTAGAAGTTATCTTGACGG - Intronic
919641403 1:200048281-200048303 TAAGCTAGAAGCCATGTCTCAGG + Exonic
920062525 1:203237515-203237537 TGAGTTACAAGGGATGTTGAAGG - Intronic
920527723 1:206680085-206680107 TAAGATAGAAGGGATGATAGAGG + Intronic
921213912 1:212921503-212921525 TTAGCAATAAGGGATGTTGAAGG - Intergenic
921757620 1:218878640-218878662 CAAGCTAGAAGAGAGGTTGGAGG - Intergenic
922149787 1:222989761-222989783 TTAGCTAGAAGGAAAGTTACAGG + Intronic
922987687 1:229878760-229878782 AAAGCCAGAAGGGATGCAGCTGG + Intergenic
923640379 1:235753105-235753127 TAAGGTAGCAGATATGTTGCTGG - Exonic
924209219 1:241747723-241747745 TATGCGAGAATCGATGTTGCAGG + Intronic
924886496 1:248223307-248223329 GAAGCTAGGAGGGAGGTTGAGGG - Intergenic
1063437730 10:6048200-6048222 TAAGCAAGAAGAGGGGTTGCTGG + Intronic
1063515799 10:6693848-6693870 AAAGCTAGAAGGCAGGTGGCAGG - Intergenic
1064459378 10:15519240-15519262 TAAACTAGAGGGGCTGTTGAGGG - Intronic
1069624881 10:69861383-69861405 TAAGCTGGAGGGGATCTTACTGG + Intronic
1072155789 10:92722684-92722706 CAAGCTCAAAGGGATGTTGAGGG - Intergenic
1073440863 10:103551948-103551970 TAAGCAAGCAGGGATGGGGCAGG - Intronic
1074053663 10:109902894-109902916 TAAGCCACAGGGGATGTTCCAGG - Intronic
1075709540 10:124523257-124523279 ACAGCTAGAAGGGACCTTGCAGG - Intronic
1075836776 10:125460574-125460596 TGAGCAAGAAGGGATTTTGCTGG + Intergenic
1081835212 11:46147918-46147940 TAAACTAGAAGAGAAATTGCTGG - Intergenic
1083358219 11:62084029-62084051 TCAGCTATACTGGATGTTGCTGG + Intergenic
1084849959 11:71930601-71930623 AAAGCTAGAAGGGGTCTTGGAGG - Intronic
1090314161 11:125770200-125770222 TGAGGTGGAAAGGATGTTGCTGG - Intergenic
1093082598 12:14830377-14830399 TAAGGTAGAAAAGATGTTTCTGG + Intronic
1093933477 12:24977333-24977355 TAAGGAAGAAAGGAAGTTGCAGG + Intergenic
1098213250 12:68188214-68188236 AAAGATATAAGGGATCTTGCTGG + Intergenic
1099234173 12:80062521-80062543 GCAGGTAGAAAGGATGTTGCAGG - Intergenic
1100912642 12:99382963-99382985 AAAGCTAGAAGGGAAGTGGGTGG - Intronic
1102840147 12:116110978-116111000 TAAGCTATAATGGATGTAACTGG + Intronic
1103192600 12:119014859-119014881 CAAGCTAGAAGGGGTGTAGTTGG - Intronic
1104160280 12:126172593-126172615 TAAAGGAGAAGAGATGTTGCTGG + Intergenic
1105786148 13:23751236-23751258 TAAGCTAGAAGAGATGATATAGG + Intronic
1107905743 13:45059505-45059527 GAAGCAAGAAAGGATGTAGCAGG - Intergenic
1111545158 13:89723807-89723829 TAACATAGAATGGATGTTCCTGG + Intergenic
1114429119 14:22645440-22645462 TAAGCTGGAAGGGATTCAGCGGG + Intergenic
1115806097 14:37053641-37053663 GAAGCTAGAAGGGAAGTTTCTGG - Intronic
1117428393 14:55624995-55625017 AAAGCTAGAAGGGTTGGAGCAGG + Intronic
1117456066 14:55898096-55898118 TGATCTTGAAGGGACGTTGCTGG + Intergenic
1119762606 14:77162354-77162376 TAGGCTAGTAAGGAAGTTGCTGG + Intronic
1121089794 14:91173363-91173385 CAAGCTGGAAGGGCTGGTGCGGG + Exonic
1126754198 15:51909138-51909160 TAAATCAAAAGGGATGTTGCTGG + Exonic
1127624576 15:60767739-60767761 AAAGCAAGAAGGGAGTTTGCAGG - Intronic
1128205992 15:65852464-65852486 TCAGCTACAAGGAATGTAGCTGG + Intronic
1129171611 15:73811492-73811514 AGAGGAAGAAGGGATGTTGCAGG + Intergenic
1130381068 15:83372861-83372883 TAAGCTAGAAGGGGTTCTGTAGG - Intergenic
1130452470 15:84070223-84070245 GAAGCTGGGAGGGATCTTGCAGG - Intergenic
1144147873 17:12415646-12415668 TAAGGTAGAAGACATGTGGCGGG + Intergenic
1145006502 17:19341584-19341606 TAAGCTGGCAGGGAGGGTGCTGG + Intronic
1147500936 17:40963028-40963050 AAAGCTGGAGGGGATGTTGGAGG + Intronic
1149291336 17:55220526-55220548 TCAGCTACCAGGGATGTTGGAGG - Intergenic
1150322929 17:64231539-64231561 CAAGATAGAGTGGATGTTGCTGG - Intronic
1153168235 18:2285945-2285967 TATGGTAGATGGGAGGTTGCAGG + Intergenic
1154126925 18:11699898-11699920 TACTCTATGAGGGATGTTGCTGG + Intronic
1154951660 18:21216217-21216239 TAAGATAGAAAGGATGTGGATGG + Intergenic
1158355105 18:56609370-56609392 TAGGCTAGAAGGGATGTGAGGGG + Intronic
1168434128 19:56304053-56304075 TAACTCAGAAGGGATCTTGCTGG - Intronic
925219736 2:2128824-2128846 TTGGCTAGAAGGGATGATGAAGG - Intronic
928564238 2:32527273-32527295 TAAGCTAGACTGGATGATGTAGG + Intronic
929216696 2:39421763-39421785 TAAGCAAGAAGAGATCATGCAGG - Intronic
933845705 2:86325449-86325471 TAAGGTAAAAGGGACTTTGCAGG + Intronic
937103925 2:119293103-119293125 TAGGCCAGCAGGGATGTTTCTGG - Intergenic
944243863 2:197512208-197512230 TAAGCCAGAATGGCTGCTGCAGG + Intronic
945627551 2:212229651-212229673 GAAGCTAGAAGGGAAGTTTAGGG + Intronic
1169402173 20:5291950-5291972 TAAACAAGAATGGATGCTGCTGG + Intergenic
1173701389 20:45074999-45075021 TAAGCTAGAAGAGAAGTGGAAGG - Exonic
1174058881 20:47818583-47818605 TGAGCTAGGAGGGCTGTTGCGGG + Intergenic
1175241123 20:57550202-57550224 TCAGGTTGAATGGATGTTGCAGG + Intergenic
1179309500 21:40183261-40183283 TATGCTCGAAGGGATGTTAAAGG + Intronic
1179579578 21:42332665-42332687 AGAGCTAGAAGGGATGGTGAAGG - Intergenic
1180745991 22:18089335-18089357 TGAGCTGGAAGGGATGTGGGGGG + Exonic
1181322678 22:22020429-22020451 TGAGCTATAAGGGATGATGGTGG + Intergenic
1182780578 22:32864253-32864275 TATGCAAGCAGGCATGTTGCAGG + Intronic
1182983533 22:34695450-34695472 TGAGCTAGAAGGGATCTTTAGGG - Intergenic
1184387430 22:44184059-44184081 TCTCCTAGAAGGGAGGTTGCAGG - Intronic
949327730 3:2886025-2886047 TAAGACAGAAGTGATGTTGCAGG - Intronic
949507187 3:4739000-4739022 TAGGCTAGAAGGCATTTTCCTGG - Intronic
954505048 3:51062214-51062236 TAAGCAAGATGGGAAGTTACTGG - Intronic
955485976 3:59435003-59435025 AAACCTAGAAGGGAAATTGCTGG - Intergenic
957889438 3:86336727-86336749 TAAACTAGTAATGATGTTGCTGG - Intergenic
963239978 3:142993214-142993236 GAAGGTAGAATGGAGGTTGCCGG + Intronic
967319301 3:188179585-188179607 TAAACTAGAAGGAATGCTGCTGG - Intronic
969075759 4:4576335-4576357 AGAGCTAGAAGGGATGCTGCTGG + Intergenic
970225629 4:13853804-13853826 GAATCTAGCAGGGATGTTGCAGG + Intergenic
972152002 4:36104095-36104117 TAAGGTACAAGGGATGTTATAGG + Intronic
974102515 4:57432916-57432938 TAATCTAGAACCGATGATGCTGG - Intergenic
976518570 4:86000460-86000482 TAAGCTACAAAGGATGTTGGGGG - Exonic
976831756 4:89323052-89323074 TAAGATAGAAGGAATGTAGGAGG - Intergenic
979847828 4:125538816-125538838 AGAGCTAGGAGGGTTGTTGCAGG + Intergenic
980886469 4:138767998-138768020 GAACCTAGAAGGGATTTTACTGG - Intergenic
980894795 4:138851739-138851761 GAAACTGAAAGGGATGTTGCGGG + Intergenic
981509118 4:145535709-145535731 TAAGTTAGAAGGGATGTGGTAGG + Intronic
981574828 4:146193739-146193761 TACGGTAGAGTGGATGTTGCTGG + Intronic
982058712 4:151580598-151580620 ATATCTAGAAGGGAAGTTGCAGG - Intronic
982833376 4:160091034-160091056 AAAGATATAAGGGATGTTTCAGG + Intergenic
984232540 4:177116055-177116077 TAATCTAGGAGGTATTTTGCAGG + Intergenic
986013508 5:3738152-3738174 GAAGCTAGAAGGGGTATTGCAGG + Intergenic
990780701 5:59358767-59358789 AAGAGTAGAAGGGATGTTGCTGG + Intronic
992309483 5:75481048-75481070 TGAGCGAGATGGGAAGTTGCTGG - Intronic
992483280 5:77171973-77171995 AAAGCTAGAAAGGATTGTGCTGG - Intergenic
994671896 5:102771854-102771876 TATGCTAGAAGGGCTGTGGCTGG + Intronic
997796551 5:136816723-136816745 TAACCTGGAAGGCATGTGGCTGG - Intergenic
999015373 5:148098019-148098041 AAAGAAAGAAGGGATCTTGCAGG + Intronic
1001241951 5:170077913-170077935 AAAGGTAGAAGGGATGTTGCCGG - Intronic
1004003741 6:11620525-11620547 TATGCTAGAAGGGATGCTAGAGG + Intergenic
1005144969 6:22679219-22679241 TAAGGAAGAAGGAATGCTGCTGG + Intergenic
1006869433 6:37237327-37237349 TCAGCAAGGAGGAATGTTGCAGG - Intronic
1007389748 6:41544218-41544240 TAAGGTACAAGGGCTGCTGCAGG + Intergenic
1010037108 6:71338716-71338738 TAATCTACAAGGGATTTGGCTGG + Intergenic
1010493077 6:76497192-76497214 TAATTTAGCAGGAATGTTGCTGG - Intergenic
1011433890 6:87316905-87316927 GAAGTTAGAAAGGATGTTTCAGG - Intronic
1013264294 6:108479504-108479526 TAAGCTATGAGGGATCTTTCAGG + Intronic
1016323915 6:142878505-142878527 GAAGCAGGAAGGGATGGTGCCGG + Intronic
1017624527 6:156334784-156334806 TATGAGAGAAGGGATGTTGCAGG - Intergenic
1018271975 6:162089518-162089540 ATACCTAGAAGGGAAGTTGCTGG - Intronic
1018339134 6:162830825-162830847 GCAGCTAGAAGGGATGTCTCAGG - Intronic
1020635869 7:10695521-10695543 TTAGCTAGAAGTTATGTTTCTGG - Intergenic
1024973784 7:55094617-55094639 GAAGTTAGAAAGGAAGTTGCTGG - Intronic
1034649468 7:152678140-152678162 TAAACGAGAAGTGATGTTTCCGG - Intergenic
1046714311 8:117550693-117550715 TATGATGGAAAGGATGTTGCAGG - Intergenic
1049295699 8:141835092-141835114 TAAGCTAGGAGGGTTGTACCAGG + Intergenic
1051813452 9:21076639-21076661 TAAGCTTGCAGGGATGGTGGGGG + Intergenic
1053440139 9:38109267-38109289 TGAGCAAGAGGGGCTGTTGCTGG + Intergenic
1056198343 9:84250312-84250334 TCAGACAGATGGGATGTTGCTGG + Intergenic
1057548656 9:96036217-96036239 GAAAGTAGAAGGGTTGTTGCTGG - Intergenic
1058028822 9:100173425-100173447 TAAGTCAGAAGAGATGTTTCAGG + Intronic
1058501710 9:105625976-105625998 TAAACTAGATGGTATGTTGCTGG + Intronic
1059909137 9:119022961-119022983 GAAGCTAGAAGGGATCTTCAAGG - Intergenic
1060743396 9:126114156-126114178 AGAGCCAGAAGGGATGTTGGTGG - Intergenic
1061361223 9:130143540-130143562 TACGCTAGAATGGCTGATGCAGG - Intergenic
1185619568 X:1445178-1445200 TAAGCTAGAAGCGATCTTGAGGG + Intronic
1190701660 X:52993779-52993801 TATGCTATCAGGGATGTTGTTGG + Intronic
1194026956 X:88764433-88764455 TAAGCTATAAGGTATGTTTGGGG - Intergenic
1197286458 X:124600868-124600890 TTTGCTATAAGGGATGTTGCTGG + Intronic
1201338354 Y:12904492-12904514 TAAGGAAGAAGGGAAGTTGAGGG + Intronic
1201963240 Y:19705775-19705797 TATGCTAGCAGGAATGTTGCTGG + Exonic