ID: 909650164

View in Genome Browser
Species Human (GRCh38)
Location 1:77966078-77966100
Sequence CTGCAAGCTGAACCTTCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909650163_909650164 19 Left 909650163 1:77966036-77966058 CCTAGTAATGAGGGAGAACTAAC No data
Right 909650164 1:77966078-77966100 CTGCAAGCTGAACCTTCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909650164 Original CRISPR CTGCAAGCTGAACCTTCAGT AGG Intronic
No off target data available for this crispr