ID: 909659064

View in Genome Browser
Species Human (GRCh38)
Location 1:78062372-78062394
Sequence CAGAGAACACAGAAGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 985
Summary {0: 1, 1: 1, 2: 8, 3: 90, 4: 885}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909659064_909659071 24 Left 909659064 1:78062372-78062394 CCTTCCTTCTTCTGTGTTCTCTG 0: 1
1: 1
2: 8
3: 90
4: 885
Right 909659071 1:78062419-78062441 TTCCTGCCTGTATGTAAAAGTGG 0: 1
1: 0
2: 0
3: 16
4: 185
909659064_909659074 28 Left 909659064 1:78062372-78062394 CCTTCCTTCTTCTGTGTTCTCTG 0: 1
1: 1
2: 8
3: 90
4: 885
Right 909659074 1:78062423-78062445 TGCCTGTATGTAAAAGTGGGTGG 0: 1
1: 0
2: 1
3: 11
4: 155
909659064_909659072 25 Left 909659064 1:78062372-78062394 CCTTCCTTCTTCTGTGTTCTCTG 0: 1
1: 1
2: 8
3: 90
4: 885
Right 909659072 1:78062420-78062442 TCCTGCCTGTATGTAAAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909659064 Original CRISPR CAGAGAACACAGAAGAAGGA AGG (reversed) Intronic
900285100 1:1895274-1895296 CAAAGGACAGAGAATAAGGAGGG + Intergenic
900738650 1:4316871-4316893 TAGAGAACACAGAAAATGGAGGG + Intergenic
900856963 1:5194013-5194035 CACAGAACACAGAATTAGGCAGG + Intergenic
900959601 1:5910462-5910484 CAGAGGCCACAGGAGAGGGAGGG - Intronic
901309907 1:8261397-8261419 CCTAAAACAAAGAAGAAGGAAGG - Intergenic
901397569 1:8992572-8992594 TAGAGAACAAAGCAGCAGGAAGG - Intergenic
901855987 1:12044240-12044262 CAGAGAGGACTGATGAAGGATGG + Intergenic
903269564 1:22178795-22178817 CAGAGAAGGAAGGAGAAGGAAGG - Intergenic
903303169 1:22393273-22393295 CACAGAACTCAGCAGAATGATGG + Intergenic
903574546 1:24330797-24330819 CAGGGCACACAGAGGCAGGAAGG - Intronic
904726158 1:32549914-32549936 CAGCCAAAACAGAAGAAAGATGG + Intronic
904757248 1:32774696-32774718 CAGAGGACAAAGGAGAAGGGAGG + Exonic
905456351 1:38090706-38090728 CAGTGAACACAGAAGGGTGAAGG + Intergenic
905618617 1:39420567-39420589 CAGGGAACACTGAAAAAGGAAGG - Intronic
905941000 1:41863281-41863303 CAGAGAACGCTGGAAAAGGATGG + Intronic
906056643 1:42923292-42923314 CAGAGAACAGAGTGGATGGATGG + Intergenic
906265948 1:44429614-44429636 CAGAGAGCTGAAAAGAAGGAGGG + Intronic
906488944 1:46252627-46252649 TAGGGAACACAGAAGAAGAATGG + Intronic
907146208 1:52234174-52234196 TAGAGAACACAGGGGAAGAACGG - Intronic
907475539 1:54702903-54702925 CAGAGAACACACTAGAAGTCAGG - Intronic
907888634 1:58617357-58617379 TACAGAGCACAAAAGAAGGAAGG - Intergenic
908973256 1:69864133-69864155 AAGAGAGCACATAAGAGGGATGG - Intronic
909284930 1:73803925-73803947 CAGAAAACAAAGAATAAGCAAGG + Intergenic
909319386 1:74264064-74264086 ATGAGAAAATAGAAGAAGGAGGG + Intronic
909339967 1:74520685-74520707 CTGAGAACAAAAGAGAAGGAAGG + Intronic
909507750 1:76413130-76413152 CAGAGGAAATAGGAGAAGGAAGG - Intronic
909525660 1:76619853-76619875 CAGAGGAGGGAGAAGAAGGAGGG - Intronic
909659064 1:78062372-78062394 CAGAGAACACAGAAGAAGGAAGG - Intronic
909698960 1:78499205-78499227 GAGAGAACAGAGAAGAAAGAGGG - Intronic
909700607 1:78517676-78517698 TTGAGGACACAGAAGAAGGTAGG + Intronic
910220051 1:84880822-84880844 CAGAGGGTACAGAAGAAGGAAGG + Intronic
910584642 1:88865944-88865966 CAAAGAACAGAGAAAACGGAAGG + Intronic
910774100 1:90857774-90857796 CAGAGAACACAGAAATAACAGGG + Intergenic
911099348 1:94081802-94081824 CCGAGAACTCAGGAGAAGGCTGG + Intronic
911176848 1:94825842-94825864 CAAAGAAGACAGGAGGAGGAAGG + Intronic
911247630 1:95535866-95535888 CAGAGAACACAGCACAGGCAGGG - Intergenic
911758743 1:101591408-101591430 CAGAGAAAACAGTTGAATGAAGG - Intergenic
912507911 1:110168950-110168972 CAGAGAAGATAGAAAAAGGAAGG - Intronic
913115174 1:115690411-115690433 CAGAGAACTCAGGAGAGGGAAGG + Intronic
913115360 1:115691875-115691897 CAAAGAACAAAGATGAAGGCAGG - Exonic
913528634 1:119716522-119716544 GAGAGAACATTGAAGAAGGATGG + Intronic
913530167 1:119728293-119728315 CAGACAAAACAAAAGCAGGAAGG - Intronic
914344387 1:146785942-146785964 CAGAGAAGACTGGAGCAGGAAGG - Intergenic
914939237 1:152007430-152007452 CAGAGATCAAAGAAGGAGGCTGG - Intergenic
915625876 1:157113819-157113841 CAGGGAAGACAGGAGCAGGAAGG - Intergenic
915744199 1:158143508-158143530 AAGGGAAAACAGAAGAAGAATGG + Intergenic
916060740 1:161097084-161097106 CAGAGAACACAGCATGGGGATGG - Intergenic
916560588 1:165931280-165931302 CACAGAGCCCAGAAGTAGGAAGG - Intergenic
916684056 1:167128442-167128464 CAGAAAACAGAGAAGAAGGGAGG + Exonic
916888455 1:169093488-169093510 CAGAGAACAACTAAGAAGAAGGG - Intergenic
917202667 1:172533470-172533492 CAGAGAGCACAGAAAGAGGCAGG - Exonic
917307272 1:173639474-173639496 AAGAGAACACAGAAGGAAAATGG + Intronic
918079128 1:181192213-181192235 CAGGGAACACAGAAGATGTGAGG - Intergenic
918746024 1:188200852-188200874 TAAGGAACACAGAAGTAGGAAGG - Intergenic
919061586 1:192640902-192640924 TTGAAAACACAGAAGAAAGAAGG - Intronic
919237750 1:194868216-194868238 CAGAGAAAAAAAAAAAAGGAAGG + Intergenic
919333050 1:196195429-196195451 GAAAGAAAACAGAAGAAAGAAGG + Intergenic
919502125 1:198350257-198350279 AAGAGAACATAGAAGAGGAAAGG - Intergenic
919813075 1:201421152-201421174 CAAAGAACACAGAAGCAAGATGG + Intronic
920049528 1:203154926-203154948 CAGAGAAAAAAGAAGGAAGAGGG - Intronic
920186024 1:204159989-204160011 CTGAGTTCACAGAAAAAGGAAGG + Intronic
921173029 1:212565916-212565938 AGGAGAACACACTAGAAGGAAGG - Intronic
921200598 1:212801864-212801886 GAGAGAACAAAGATGAAGGAGGG - Intronic
921285043 1:213601932-213601954 AAGAGAAAAGAAAAGAAGGAAGG - Intergenic
921325866 1:213985839-213985861 CGGAGAGCAGAGAAGGAGGAGGG - Intronic
921367430 1:214386929-214386951 CAGAGAACACAGAGGAGGTGGGG + Intronic
921569427 1:216760702-216760724 CAGAGGGATCAGAAGAAGGAGGG + Intronic
922236455 1:223726256-223726278 CAGACCCCACAGAAGAAGGGAGG - Intronic
922329424 1:224561058-224561080 CAGAGAACCCAGTAGAACAAAGG - Intronic
922544259 1:226443853-226443875 CAGAGAACACATGGAAAGGAAGG - Intergenic
922690967 1:227690640-227690662 CAAAGAACACAAAATAAGGTTGG + Intergenic
923327019 1:232888938-232888960 AAGAAAATAAAGAAGAAGGAAGG - Intergenic
923348364 1:233079751-233079773 CAGCGAACACAAAGGAAGGCTGG - Intronic
923477654 1:234350207-234350229 CAAAGAAGAAAGAAGAAAGAAGG + Intergenic
923922013 1:238577499-238577521 CAGAGAACACAGAAGCAGCTGGG + Intergenic
924089205 1:240485534-240485556 CAGAGAAGAAAGAACATGGAGGG - Intergenic
924160010 1:241221145-241221167 AAAAGAAAACAAAAGAAGGAAGG + Intronic
924215966 1:241822884-241822906 CATAGAATGGAGAAGAAGGATGG - Intergenic
1063221723 10:3975183-3975205 CAGAGAGACCAGAAGAAGGAAGG + Intergenic
1063347219 10:5323333-5323355 CAGAGAACTCTGAAGTTGGAAGG + Intergenic
1064108904 10:12522159-12522181 CATATAACACAAAAGAAGGCAGG - Intronic
1064973407 10:21089047-21089069 CAGAGGAGACAGAAAAAGGGAGG + Intronic
1065308555 10:24391959-24391981 AAGACAACACAGAAGAAAGTAGG + Intronic
1065348038 10:24767723-24767745 AAGAGAAAACAAAAGAAGGAAGG - Intergenic
1065667680 10:28080129-28080151 AAGAGAAAAGAAAAGAAGGAAGG + Intronic
1065750439 10:28881273-28881295 GAAAGAAGGCAGAAGAAGGAAGG + Exonic
1065806536 10:29398369-29398391 CTCAGAGCACAGAAGGAGGACGG - Intergenic
1065881126 10:30038743-30038765 GAGAGAAGAGAGAAGCAGGATGG + Intronic
1065952375 10:30663922-30663944 CAGAGAAAAGAGATGAGGGAAGG - Intergenic
1068068873 10:52170186-52170208 CTGAGGACAAAGAAGAAAGAAGG + Intronic
1068163065 10:53292991-53293013 TGGAGAGCTCAGAAGAAGGAAGG + Intergenic
1068231862 10:54178103-54178125 CAGCCAACAGAGAAGTAGGATGG + Intronic
1068238103 10:54264441-54264463 CATAGAACTCAGAAGATGGATGG + Intronic
1069281689 10:66662583-66662605 CAGAAAGGACAGAGGAAGGAAGG - Intronic
1069408356 10:68126636-68126658 GACACACCACAGAAGAAGGATGG + Intronic
1069731002 10:70613293-70613315 CAGTCAACCCAAAAGAAGGAAGG - Intergenic
1069786068 10:70988709-70988731 CACAGTACCCAGAACAAGGAGGG - Intergenic
1070210410 10:74313309-74313331 CAAAAAAAACAGAAGAAAGATGG - Intronic
1070223510 10:74475800-74475822 AAGAGAAGAGAGAAAAAGGAGGG + Intronic
1070645856 10:78202022-78202044 CAGAGAAAAGAGCTGAAGGACGG + Intergenic
1070676710 10:78416899-78416921 CAGAGAACAGTGGAGATGGAGGG - Intergenic
1070920633 10:80183383-80183405 CTGAGATCCCAGAGGAAGGAAGG - Intronic
1071310044 10:84334845-84334867 CAGAGAACAGAGGGTAAGGATGG - Intronic
1071848041 10:89540021-89540043 CAGAGAAAAGAAAGGAAGGAAGG - Intronic
1071998275 10:91168291-91168313 CTGAGAAGAAAGAAGCAGGAGGG + Intronic
1072292177 10:93974298-93974320 CAGGGAGCTCAGAAGAAGGTGGG + Intergenic
1072379306 10:94850954-94850976 CAAAGGTCACAGAAAAAGGAAGG - Intronic
1072828172 10:98629493-98629515 CAAAAAACACAAAAGAAGGATGG - Intronic
1073112602 10:101071578-101071600 AAGAGGACACAGAAGAAGGAAGG - Intergenic
1073137793 10:101229374-101229396 CAGAGAAGAGAGAAGAGAGAGGG - Exonic
1074233946 10:111565956-111565978 CACAGAGCAAAGCAGAAGGACGG + Intergenic
1074296374 10:112193148-112193170 CAGAGAAGACAAAAGTAGAAGGG + Intronic
1074430040 10:113386689-113386711 GAGAGATCAAAGAAGCAGGAAGG - Intergenic
1074970826 10:118535367-118535389 CAGAATACACAGAAGACAGAAGG - Intergenic
1075192782 10:120326326-120326348 CAGAGAGTAGAAAAGAAGGAAGG - Intergenic
1075743465 10:124710128-124710150 CAGAGGGCACAGCAGCAGGATGG + Intronic
1075775307 10:124980347-124980369 CAAAGACCACTGAAGAAGGGAGG - Intronic
1075786307 10:125052511-125052533 CAGACAACACAAAGGCAGGACGG - Intronic
1075855236 10:125624359-125624381 CAGAGACCAGAGAAGAAAGTGGG + Intronic
1075911611 10:126129929-126129951 TCTAGAACATAGAAGAAGGAGGG - Intronic
1076259745 10:129055886-129055908 CAGTGAACACAGCGGCAGGAGGG + Intergenic
1076533393 10:131160343-131160365 CTGGGAGCACAGAGGAAGGATGG - Intronic
1076599297 10:131646716-131646738 CTGAGAACACACCACAAGGAAGG - Intergenic
1077617214 11:3685381-3685403 CAGTGGACACAGAAAAAGCAGGG + Intronic
1077736930 11:4801157-4801179 CAGAGAACTCAGAAGAAGACAGG - Intronic
1078189195 11:9077563-9077585 CAGAGAACTCAGGAGAAGTTAGG + Intronic
1078192522 11:9103737-9103759 CAGTGACCACAGAAGAAAGCGGG - Intronic
1078257901 11:9675719-9675741 CAGGGAATGCAGGAGAAGGAAGG - Intronic
1078526773 11:12107436-12107458 GAGAGAAAAAAGAAGAAGGAAGG - Intronic
1078546136 11:12248365-12248387 CTGAGATCACAGAAGAGGGCTGG - Intronic
1078612277 11:12831011-12831033 CAGAGAACAAGAGAGAAGGAGGG - Intronic
1078917046 11:15788087-15788109 CAGTGAAGACAGAAAAAGTAAGG + Intergenic
1078932863 11:15926316-15926338 CAAAGCAGACAGAAGAAGGTGGG + Intergenic
1079315524 11:19404947-19404969 CAGAGAGCACAGAGAGAGGAGGG - Intronic
1079378840 11:19918903-19918925 CAGAGCATAAAGCAGAAGGAAGG - Intronic
1079414766 11:20223421-20223443 CAGAGAAGAAAGATGTAGGAAGG - Intergenic
1079433681 11:20422860-20422882 CAGGGGACTCAGAAGAAGTAGGG + Intronic
1079506957 11:21163720-21163742 CTGAGGACACAGAAAAAGGCAGG - Intronic
1079524954 11:21374976-21374998 CAGAGAAGAAGGAAGAAGGCAGG + Intronic
1079645198 11:22854632-22854654 TAGAGAATGCAGAAGAAGAATGG + Intronic
1079659501 11:23021006-23021028 CAGACAACCCAGAAGGAAGAAGG - Intergenic
1079848012 11:25494737-25494759 CATCCAACACAGAAGAAGGATGG + Intergenic
1079923555 11:26462481-26462503 CAGAGAACACTGAAAAATGATGG - Intronic
1079962162 11:26937998-26938020 AAAAGAAGACAGAAAAAGGAGGG - Intergenic
1079973292 11:27062252-27062274 TAGGCAACAGAGAAGAAGGAAGG + Intronic
1080048932 11:27838586-27838608 GAGAAAAGAAAGAAGAAGGAAGG - Intergenic
1080186521 11:29493846-29493868 CAAAGAAGACAGAAGGAAGAGGG - Intergenic
1080450534 11:32375289-32375311 CAGATACCACATAAGAAAGAGGG + Intergenic
1080515730 11:33017697-33017719 CAGAGCACACAGAAAGAGAATGG - Intronic
1081100463 11:38995478-38995500 CAGATTTCTCAGAAGAAGGAAGG - Intergenic
1081484968 11:43520537-43520559 CAGACAACACAGAGGAATTAGGG - Intergenic
1082611995 11:55311181-55311203 CAGAGAAGACTAAGGAAGGAGGG - Intergenic
1082621048 11:55422577-55422599 AAAAGAAGAAAGAAGAAGGAAGG - Intergenic
1082628372 11:55511826-55511848 GAGAGAAGAAAGAAGCAGGAAGG - Intergenic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1083027421 11:59562397-59562419 CAGAGAAATCACTAGAAGGAAGG + Intergenic
1083687765 11:64387241-64387263 CAAAGAACACAAATGAAAGATGG + Intergenic
1084349246 11:68582778-68582800 CAGAAAACAGACAAGAAGAAAGG - Intronic
1085364628 11:75928361-75928383 GATAGAACAGAGGAGAAGGACGG + Intronic
1085567147 11:77524550-77524572 CAGAGAACACAGAAGAGGGCAGG - Intronic
1085670526 11:78460081-78460103 CTGAAGACACAGAAGAAGGGTGG + Intronic
1086000757 11:81983383-81983405 CAGAGAAGACAGAAAAAAGGAGG - Intergenic
1086203570 11:84232643-84232665 GTGAGGACACAGCAGAAGGATGG + Intronic
1086354469 11:85980234-85980256 CAGAGGATAGAGAAGGAGGATGG + Intronic
1086532690 11:87804329-87804351 CAGAGAACAGAGGACAATGATGG - Intergenic
1086947798 11:92860466-92860488 GAGAGAAGGCAGGAGAAGGAGGG + Intronic
1087534062 11:99421372-99421394 CAGAGAACTGGGAAGAAGAATGG + Intronic
1087622215 11:100555152-100555174 TTGAGAAAACAGCAGAAGGAAGG + Intergenic
1088011006 11:105001068-105001090 GAGAGAACACAGGAGTTGGACGG - Intronic
1088319486 11:108540784-108540806 CAGAGATCAGAGGAGAAGGGAGG - Intronic
1088535128 11:110852235-110852257 GAGAGAGCACAGAAGGATGAAGG + Intergenic
1088973860 11:114797374-114797396 GAGAGAAAATAGAAGAAGGTGGG - Intergenic
1089137902 11:116264141-116264163 GAGAGAACCCACAGGAAGGATGG + Intergenic
1089220828 11:116870058-116870080 CAGGGGACAAGGAAGAAGGAGGG + Intronic
1089410856 11:118241480-118241502 CTGAGAAGACTGAAGAAGTACGG - Intronic
1089691732 11:120191106-120191128 CACAGAACACGGTAGCAGGAGGG + Intergenic
1090378699 11:126309886-126309908 CAGAAAAGGCAGAAGAAGAAGGG - Intronic
1090566306 11:127995632-127995654 CAGAGAACAGAGAAGATGAGTGG - Intergenic
1090667866 11:128926874-128926896 CAGAGGACACAGAAGCGGGATGG - Intergenic
1090822891 11:130360790-130360812 CTGAAAACACAGTAAAAGGATGG - Intergenic
1090879911 11:130824413-130824435 GAGAGGACACAGAAGAAGAGAGG - Intergenic
1091375507 12:22481-22503 GAGAGAACAGGGGAGAAGGAAGG + Intergenic
1091757190 12:3061692-3061714 CAGAGATCTTTGAAGAAGGAGGG - Intergenic
1092225492 12:6745622-6745644 CAGAGAACCCTGAAGGAGCAAGG + Intergenic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092461146 12:8687417-8687439 AAGTGACCACAGAAGGAGGATGG - Intronic
1092485009 12:8895474-8895496 CAGAGAACCCAAAAGAAAAATGG - Intergenic
1092585731 12:9899377-9899399 GAGAGAACAGAGGAGAAGAAAGG + Intronic
1093479065 12:19585659-19585681 AAGAGAAGAAGGAAGAAGGAAGG + Intronic
1093576450 12:20736259-20736281 CAGAGAACAAAAAAAAATGAAGG + Intronic
1093694553 12:22145409-22145431 CAGAAAACACAGAATATGGCCGG + Intronic
1094210576 12:27885756-27885778 CTGGGAACAAAGAAGAAGGGTGG - Intergenic
1095042608 12:37459411-37459433 CCGAAGACACAGAAGAAGGCAGG - Intergenic
1095581873 12:43809211-43809233 CAGAGAAGAAACAAGATGGATGG - Intergenic
1095604629 12:44052392-44052414 CAGAAAAGAAAGAACAAGGAGGG + Intronic
1095919271 12:47513251-47513273 CAGAAAGCAAAGAAGAAGCAAGG - Intergenic
1095995587 12:48081005-48081027 CAGAGGAGGCAAAAGAAGGAAGG + Intronic
1096016480 12:48280747-48280769 CAGATACCAGAGAAGGAGGAAGG - Intergenic
1096077952 12:48816558-48816580 CAGAGATATGAGAAGAAGGAGGG + Intronic
1096815054 12:54196542-54196564 CAGACCACACAGACTAAGGAAGG + Intergenic
1097154151 12:57000708-57000730 CAGAGGACACTGAACAAGGTGGG + Exonic
1097156366 12:57015132-57015154 GGGAGAAAAGAGAAGAAGGAAGG + Intronic
1097245618 12:57606089-57606111 CAGAGAAGAGAGGAGATGGAAGG + Intronic
1097548051 12:61029398-61029420 AAGAGAACGAAGAAGAAAGAAGG - Intergenic
1097680561 12:62645269-62645291 CTGAGAACACAGTAAGAGGAGGG + Exonic
1097786312 12:63764016-63764038 AAGAGAACAGAAAAGAAGAAAGG + Intergenic
1098150948 12:67545604-67545626 CACACAACACAGAAGGAGGGAGG + Intergenic
1098332801 12:69372504-69372526 CAGAAAACAGAGTAGAATGACGG - Intronic
1098579901 12:72087386-72087408 CTGAAGACACAGAAGAAAGATGG + Intronic
1098769006 12:74528690-74528712 CAGAAAAAAAAGAAGAATGATGG - Intergenic
1099246408 12:80198022-80198044 CAGAAAACAAAGAGGAAGAAAGG - Intergenic
1099393544 12:82110074-82110096 GAGAGAGGAGAGAAGAAGGAAGG + Intergenic
1099830877 12:87840972-87840994 AAGAGAAAACAGAAAAAGCAAGG - Intergenic
1099904321 12:88754021-88754043 CAGAGGCCACAGGAGGAGGATGG + Intergenic
1100040510 12:90311821-90311843 CAGAGAATAAAGAAGACAGAGGG + Intergenic
1100081410 12:90855691-90855713 CAGACAACAAAAAAGAAGGAAGG + Intergenic
1100123545 12:91396117-91396139 GAGAGAAGAATGAAGAAGGAAGG - Intergenic
1100889479 12:99108661-99108683 AAGAGAACAGATAAGAAGGTAGG + Intronic
1101145728 12:101838867-101838889 CAGAGCAAACAGAATAAGGGGGG - Intergenic
1101821228 12:108185714-108185736 CAGAGAACAGGGAGGAAGGCAGG - Intronic
1102216511 12:111165272-111165294 CTGAGAAAAGAGAAGTAGGAAGG + Intronic
1102318725 12:111912411-111912433 CAGAGAAGGCAGATAAAGGATGG - Intergenic
1102548563 12:113674274-113674296 CAGAAAAGAGAGAGGAAGGAAGG - Intergenic
1102624175 12:114221063-114221085 AGGAGAACAGAAAAGAAGGAAGG + Intergenic
1102831029 12:115999851-115999873 CAGAGAACACACAAAAAAGCAGG + Intronic
1103185443 12:118953164-118953186 CAGAGGACTCAGAATAAGGAAGG + Intergenic
1104121622 12:125805408-125805430 GTGATAACACAGAAGAGGGATGG + Intergenic
1104133464 12:125916434-125916456 CATCCAACACAGAAGAACGAAGG - Intergenic
1104377352 12:128276547-128276569 CTGAGAACTCAGAAGGAGAAGGG - Intronic
1104417810 12:128609680-128609702 CAGAGAGCATGGATGAAGGAGGG + Intronic
1104657122 12:130581614-130581636 CAAAGAGAACAGAGGAAGGAAGG - Intronic
1104980331 12:132570625-132570647 CAGAGACCACAGCAGGTGGAGGG - Intronic
1105575812 13:21650574-21650596 CAGAGAAAGAGGAAGAAGGAGGG - Intergenic
1105899399 13:24742581-24742603 CAGAGCAGACAGGAGCAGGAGGG - Intergenic
1106925083 13:34605437-34605459 TTGAGAAAACAGAAGCAGGAAGG + Intergenic
1107126453 13:36851477-36851499 GCCAAAACACAGAAGAAGGATGG - Intronic
1107272581 13:38637810-38637832 CAAAGTATACAGAAGAAGCATGG + Intergenic
1107703464 13:43073950-43073972 CAAAAAAAAAAGAAGAAGGATGG - Intronic
1108039463 13:46325762-46325784 CAAGAAACACAGTAGAAGGAAGG + Intergenic
1108144531 13:47463165-47463187 CAGAAAAGGCATAAGAAGGATGG + Intergenic
1108950245 13:56083614-56083636 CCGAGAAAATAGCAGAAGGAGGG + Intergenic
1110809361 13:79794555-79794577 TAGATATTACAGAAGAAGGAAGG + Intergenic
1111538171 13:89631360-89631382 CAGAAAATACAGATGAAAGAAGG - Intergenic
1112264804 13:97913590-97913612 GAGAGGACACAGGAGAAAGATGG - Intergenic
1112343172 13:98568945-98568967 GAAAGAACACAGAAAATGGAAGG + Intronic
1112563922 13:100536315-100536337 AAGAGAACAGAGAGGAAGGAGGG - Intronic
1112639059 13:101252258-101252280 CAGAGAACAGAGAGGAAGAAGGG - Intronic
1113738716 13:112696647-112696669 CAGAAGAGACAGGAGAAGGAAGG - Intronic
1114080774 14:19200273-19200295 CAGAGGACACAGAAGGAGGGAGG + Intergenic
1114128583 14:19761190-19761212 AAAAGAAAACAAAAGAAGGAAGG - Intronic
1114307980 14:21440866-21440888 CAGAGGACACAGAAGCAGTTAGG + Intronic
1114393113 14:22331427-22331449 CAATGAACACAAAAGAAGAAAGG + Intergenic
1114525323 14:23364490-23364512 AAGAGAAGACAGAGGGAGGAGGG - Intronic
1114596134 14:23913682-23913704 AAGAGAACAAAAAAGAAAGAGGG + Intergenic
1114928299 14:27433548-27433570 CAGAGAATACAGAAAAAAAAGGG + Intergenic
1115131532 14:30057762-30057784 CTGAGAAAACAGAAGAAAGGGGG + Intronic
1115447419 14:33507485-33507507 CAGAGAACAAAATACAAGGAGGG - Intronic
1116133289 14:40889145-40889167 CACAGAAAAAAGAAGAAGGAAGG + Intergenic
1116177257 14:41488019-41488041 CAGAAATCACAGGAGAAGTAAGG + Intergenic
1116230065 14:42204658-42204680 CAAAGAAAAGAAAAGAAGGAAGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1116950748 14:50876452-50876474 CTGAGAATACAGGAGCAGGAAGG + Intronic
1117106767 14:52405427-52405449 CTAAGAACAAAGAAGAAGGGTGG + Intergenic
1117481375 14:56148666-56148688 CAGAGAACACAGAAGAAAGGAGG - Intronic
1117784527 14:59268786-59268808 CAGAGAGCACAGAGGAAGACTGG - Intronic
1117981587 14:61347402-61347424 CAGAGAAAGCAGATGAAGGCAGG - Intronic
1118174157 14:63421300-63421322 CAGAGAAGGCAGCACAAGGAAGG + Intronic
1118652514 14:67912626-67912648 GTGAGAACACAGAGGAAGAAGGG + Intronic
1119476773 14:74934977-74934999 CAGAGAAGAGAGAAGGAGAAGGG + Intergenic
1120129990 14:80795322-80795344 CAGATAACACAGAAGGAAGAGGG - Intronic
1120188144 14:81415869-81415891 CTGAGAACTCAGAAAAAGCAAGG + Intronic
1120871383 14:89340082-89340104 GAGAGGAAAGAGAAGAAGGAAGG + Intronic
1121091783 14:91187986-91188008 CAGGGAAAACATAAGAGGGAAGG - Intronic
1121216527 14:92252815-92252837 GAGAGAAAACAGAAGAAGGAGGG + Intergenic
1121748044 14:96318206-96318228 CAAAGAACAGAAAAGGAGGACGG + Intronic
1121811434 14:96894537-96894559 CACAGAACAGAGAAGCTGGAGGG - Intronic
1122001700 14:98662609-98662631 CAGAGAGCACACAAGAAGACAGG + Intergenic
1122065206 14:99168374-99168396 CAGAAAACATAGAAAAAGAATGG + Intergenic
1122319133 14:100843198-100843220 CGGAGAAATCAGAAGCAGGAAGG - Intergenic
1122679093 14:103443024-103443046 GAGAAAACACAGAAAAATGAGGG + Intronic
1122765870 14:104069471-104069493 CAGAGAAAACAGCTGAGGGAGGG - Intergenic
1122917935 14:104867354-104867376 CAGGGAACACAGAGGCAGGGCGG - Intronic
1123571523 15:21615434-21615456 AAAAGAAAACAAAAGAAGGAGGG - Intergenic
1123608142 15:22058025-22058047 AAAAGAAAACAAAAGAAGGAGGG - Intergenic
1123695419 15:22875713-22875735 CAAACAACACAGGAGATGGAAGG + Intronic
1124059295 15:26274481-26274503 GAAAGAACACAAATGAAGGAAGG - Intergenic
1124444872 15:29721680-29721702 AAGAGAAGACAGAAAAATGAGGG + Intronic
1125810071 15:42531619-42531641 CAGAAAACAAAAAAGAAGGAGGG - Exonic
1126615351 15:50573385-50573407 CAGAGAACACTGAAGAACTGAGG + Intronic
1126909669 15:53404377-53404399 CAGAGTACAGAGAAGAAGACTGG - Intergenic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1127543919 15:59971761-59971783 GAGATAACAGAGAAGATGGAGGG + Intergenic
1127715940 15:61649577-61649599 TGGAAAACACAGAAGAACGAAGG - Intergenic
1127803171 15:62494923-62494945 CCGGGAACAGAGAAAAAGGAGGG - Intronic
1127882805 15:63173005-63173027 CAGACAACAGAGGAGCAGGAAGG - Intergenic
1128029490 15:64467245-64467267 CAGAGAACACAATAAAAAGAAGG - Intronic
1128277814 15:66368616-66368638 CATAGAACTCAAAAGAAGTATGG + Intronic
1128349271 15:66878180-66878202 CAGAGAGAAGAGGAGAAGGAGGG + Intergenic
1129039173 15:72670884-72670906 CAGTGCAGACAGGAGAAGGAGGG - Intergenic
1129656544 15:77528594-77528616 CAGAGAGCACAGAATAAGATGGG - Intergenic
1129779439 15:78260418-78260440 CAGAGAGCACAGATGGATGAAGG - Intergenic
1129876450 15:78978789-78978811 CAGGGCACACAGAGGAGGGAGGG - Intronic
1130090980 15:80821188-80821210 CAGACAACTCAGAGGAATGAGGG + Intronic
1130106507 15:80932497-80932519 CAGAGAAGGCAGAAGAGGGGCGG + Intronic
1130662832 15:85844051-85844073 CAGAGAAGACAGCATAAGGGAGG + Intergenic
1130826696 15:87555415-87555437 CAGTGCACAAAGAAGAGGGAAGG - Intergenic
1130941302 15:88511561-88511583 CAGTGGAGACAGATGAAGGAAGG - Intronic
1131646635 15:94351983-94352005 CAGAGGAAACTGAGGAAGGATGG - Intronic
1131748163 15:95472899-95472921 CAAACAACAGAGAAGAGGGATGG + Intergenic
1131828531 15:96339636-96339658 CAGAGAAAAAGAAAGAAGGAAGG + Exonic
1132050554 15:98604590-98604612 GAGAGAAGGCAGCAGAAGGAGGG + Intergenic
1132195610 15:99912537-99912559 AAGAAAAGAAAGAAGAAGGAAGG - Intergenic
1202980377 15_KI270727v1_random:349823-349845 AAAAGAAAACAAAAGAAGGAGGG - Intergenic
1132630024 16:912767-912789 CAAAGAAAACAGAAGCAGGTGGG - Intronic
1132919584 16:2379363-2379385 CAGAGCACACAGCAGCACGAAGG - Intergenic
1133064248 16:3194911-3194933 CAGAAGTCACAGAAGAAGGGCGG - Intergenic
1133487444 16:6233790-6233812 CAGAGAACATGGAGGACGGATGG - Intronic
1133534781 16:6691353-6691375 CAGAGAAGAGTGAAGAATGATGG - Intronic
1133854691 16:9538702-9538724 CAGAGAGCACAGAATAAGCCAGG + Intergenic
1133904250 16:10006811-10006833 CACAGAAGAGAGTAGAAGGATGG - Intronic
1134136594 16:11680462-11680484 CTGAGAGCACAGAATAAGGAAGG + Intronic
1134140125 16:11711212-11711234 CAGAGAAAACAGAGTAAGGGTGG + Intronic
1134571050 16:15291546-15291568 CAGATAAAATAGAAGAAGGTTGG + Intergenic
1134731327 16:16464530-16464552 CAGATAAAATAGAAGAAGGTTGG - Intergenic
1134936100 16:18247336-18247358 CAGATAAAATAGAAGAAGGTTGG + Intergenic
1135200192 16:20430644-20430666 TAGGGAACAAAGAAGAAGGGAGG + Intronic
1135218498 16:20592965-20592987 TAGGGAACAAAGAAGAAGGGAGG - Intergenic
1136083686 16:27869231-27869253 TGGAGAGAACAGAAGAAGGAGGG + Intronic
1136223955 16:28846308-28846330 CCGAGCGCACAGAAGAAGAAGGG + Exonic
1136451663 16:30357299-30357321 CTGAGAACACAGAGCAAGGTGGG + Exonic
1136475688 16:30511751-30511773 CTCAGAACACAGTAGCAGGAAGG + Intronic
1136648570 16:31645362-31645384 CAGAGGAGACTGAAGAATGAGGG + Intergenic
1136751127 16:32637197-32637219 CAGAGTACAGATAAAAAGGAAGG - Intergenic
1137043792 16:35638311-35638333 CAGAGAACAGGGATGAATGAGGG - Intergenic
1137362328 16:47829999-47830021 AGGAGAACACTGAAGAAGGATGG + Intergenic
1137396363 16:48118276-48118298 CAGAGAAAACCGAGGGAGGAGGG - Intronic
1139129081 16:64118589-64118611 ATCAGAACATAGAAGAAGGATGG - Intergenic
1139381826 16:66537331-66537353 TAGAATACACAGAAGAGGGATGG - Intronic
1139989610 16:70929407-70929429 CAGAGAAGACTGGAGCAGGAAGG + Intronic
1140363597 16:74364882-74364904 CAGAGAACAAAGAAGATGGGGGG + Intergenic
1140423617 16:74842020-74842042 AAGAGAACACAGATGAAACAAGG + Intergenic
1140602347 16:76492419-76492441 AAGAAAATACAAAAGAAGGATGG + Intronic
1141130820 16:81435297-81435319 CAAAGAAGAGAGAAGAAGGCAGG - Intergenic
1141159216 16:81617916-81617938 CAGTGGACACAGAAGAGGGAGGG + Intronic
1141433006 16:83980610-83980632 CCGAGAAAACAGAACAAGGGTGG + Intronic
1141685339 16:85566824-85566846 CAGGGAACATAAAAGAAGGGAGG + Intergenic
1203053261 16_KI270728v1_random:896452-896474 CAGAGTACAGATAAAAAGGAAGG - Intergenic
1142753583 17:2002643-2002665 CAGAGAAAAGAAAGGAAGGAAGG - Intronic
1143179745 17:4977121-4977143 CAAAGAGCACAGAAGCAGAAAGG + Exonic
1143699216 17:8645538-8645560 AAGATAATCCAGAAGAAGGATGG - Intergenic
1143791748 17:9301962-9301984 CAGAATACAGAAAAGAAGGAAGG - Intronic
1144046908 17:11462174-11462196 CAGAGAGGACAGAAGCAAGAGGG - Intronic
1144246640 17:13372658-13372680 CAGAGCACAATGAAGAAAGAAGG + Intergenic
1144352926 17:14415976-14415998 CAGAGAAAAAGAAAGAAGGAAGG - Intergenic
1144442164 17:15293275-15293297 CTGAGAAGATGGAAGAAGGAAGG - Intergenic
1144453378 17:15399487-15399509 CAGAGAAAACAGAAGATGCTTGG + Intergenic
1145901464 17:28493194-28493216 CAGAGAAGGCAGAGGAGGGAAGG + Intronic
1146011429 17:29197530-29197552 CAGACAACAAAGAAGATGGAGGG + Intergenic
1146442754 17:32911330-32911352 GAGAGAACACAGAAAGAGGTGGG + Intergenic
1146477217 17:33172689-33172711 CAGAGAACTCAGTAGTATGATGG + Intronic
1146745350 17:35323883-35323905 CAGGTCACACAGATGAAGGATGG + Intergenic
1146945239 17:36869158-36869180 CAGAGGTCACAGAGGGAGGAGGG + Intergenic
1147644991 17:42028087-42028109 CAGAGAGCACAGTGGAAGGCAGG + Exonic
1147862806 17:43533434-43533456 CAGGGATTACAGGAGAAGGAAGG + Intronic
1148180709 17:45602580-45602602 AAGAAAAGAAAGAAGAAGGAAGG - Intergenic
1148268194 17:46243346-46243368 AAGAAAAGAAAGAAGAAGGAAGG + Intergenic
1148528162 17:48363030-48363052 CAGAGTACTAAAAAGAAGGAAGG + Intronic
1148552717 17:48560112-48560134 CAGAGAAGGCAGAGGAAGGGAGG + Intronic
1148742133 17:49898822-49898844 CTGTGCACACAGAAGAGGGATGG - Intergenic
1148789050 17:50162964-50162986 GAGAGAAGGAAGAAGAAGGAGGG + Intergenic
1148789058 17:50162994-50163016 GAGAGAAGGAAGAAGAAGGAGGG + Intergenic
1149268545 17:54953394-54953416 CAGGTTACACAGAAGAAGGGGGG - Intronic
1150169062 17:62972867-62972889 CAGAGAACAAAGGAGAGGGCAGG - Intergenic
1150235957 17:63592902-63592924 AAGAGAAAAGAGAAAAAGGAGGG - Exonic
1150444741 17:65220249-65220271 CAAAGAACAGAGAAGATAGATGG - Intronic
1150522529 17:65884058-65884080 CACAGAACACAGATGAGAGACGG + Intronic
1151484526 17:74390059-74390081 AAGAGAAGAGAGACGAAGGAAGG - Intergenic
1151772790 17:76176372-76176394 GAGATAACAGAGAAGATGGAGGG + Intronic
1152246145 17:79185529-79185551 CAGAGAAGACAAAAGAGGGATGG - Intronic
1152367467 17:79864881-79864903 CAGAGGCCACAGCAGGAGGAGGG - Intergenic
1152573408 17:81130212-81130234 CTGGGAACACAGAGGCAGGAGGG - Intronic
1153098645 18:1438668-1438690 TGGAGAAGCCAGAAGAAGGATGG + Intergenic
1153104339 18:1510312-1510334 AAGAGAACACAGAAAAACAATGG - Intergenic
1153345070 18:4016807-4016829 CAGAGATCACACAGGAAGTAAGG - Intronic
1153857372 18:9163360-9163382 CAGAGAACTCAGAAATAAGATGG - Intronic
1154277785 18:12977062-12977084 CAGACCACACAGTAGAAGCAAGG + Intronic
1155521058 18:26669555-26669577 CAGAAAACACAGTAAAAGTACGG - Intergenic
1156233690 18:35180311-35180333 AAGAGATCACAAAAGAAAGAAGG - Intergenic
1156503953 18:37577407-37577429 CGGATGGCACAGAAGAAGGAAGG - Intergenic
1156550477 18:38011143-38011165 CAAAGAAGACAGAAGGAGGGAGG + Intergenic
1156584707 18:38419278-38419300 CAGAGAAAATATAAAAAGGAAGG - Intergenic
1156987498 18:43365822-43365844 AAGAGAACAAAGAAAAAAGAAGG + Intergenic
1157306253 18:46519720-46519742 CAGAGAACACAAGAGTCGGACGG - Intronic
1157319749 18:46624812-46624834 GAGAAAAGACAGAAGAAGAAAGG - Intronic
1157394438 18:47330158-47330180 CAGAGAACAAGCCAGAAGGAAGG - Intergenic
1157422303 18:47557303-47557325 CAGGGAACACAGGATAAGGTGGG - Intergenic
1157778378 18:50416422-50416444 CAGAGAAGTCAGAAAAAGAAGGG - Intergenic
1157990533 18:52490664-52490686 CAAACATCACAGAAAAAGGAGGG - Intronic
1158127739 18:54120716-54120738 CAAAGGAAACAGAAGAAGGCTGG + Intergenic
1158346624 18:56522829-56522851 AAGGGAGGACAGAAGAAGGAAGG - Intergenic
1159245688 18:65801648-65801670 GCGATAACACAGAACAAGGAGGG - Intronic
1159816312 18:73078155-73078177 CAGAGCACACGGAACAAAGAAGG - Intergenic
1159817295 18:73091164-73091186 CAGAGAATAAAGAAGAAAAAAGG - Intergenic
1159855027 18:73576244-73576266 CAGAGCAAACAGAACAAGGCTGG - Intergenic
1160030964 18:75259554-75259576 AACAGATCACAGAAGAAGAAGGG + Intronic
1160064817 18:75564837-75564859 AAGAGAACACAGAAGAAACAAGG - Intergenic
1160269903 18:77374038-77374060 CAGAGAAAAAGAAAGAAGGAAGG + Intergenic
1160322427 18:77908476-77908498 TAGAGAAGACAGAACAAGTAAGG + Intergenic
1160469961 18:79121856-79121878 TAGAGAAGACAGAATAAAGAGGG - Intronic
1160616336 18:80132583-80132605 AAGAGAAAAGAGAGGAAGGAAGG - Intronic
1160899200 19:1418705-1418727 GAGAGAACACGGCCGAAGGAAGG + Exonic
1161377518 19:3947525-3947547 GAGAGAAAAGAGAGGAAGGAAGG - Intergenic
1161970658 19:7578044-7578066 AAGAGGACACCGAAGGAGGAAGG + Intergenic
1162280116 19:9689589-9689611 CAGAGAAGACAGAACAGGTAAGG + Intergenic
1162890845 19:13732051-13732073 CAGAGAGCTCAGAAGAGGGTAGG + Intronic
1163043098 19:14617214-14617236 AAGAGAAAAGAAAAGAAGGAAGG - Intergenic
1163189771 19:15669246-15669268 CAGGGACAAAAGAAGAAGGAAGG + Intergenic
1163504496 19:17697411-17697433 AAGAGAAGACAGAAGCAGCATGG - Intergenic
1164552728 19:29225101-29225123 CATAGAACACAGAATAATAACGG - Intergenic
1164787421 19:30944639-30944661 CAAAGAAAAGAAAAGAAGGAAGG + Intergenic
1164883629 19:31758956-31758978 CTGAGAACACAGAACTTGGAGGG - Intergenic
1165844277 19:38808296-38808318 GAGAGAACAGAGAAAGAGGAAGG + Intronic
1166184655 19:41132087-41132109 AAGAGAAGAGAGAAGAAGAAAGG + Intergenic
1166438024 19:42786080-42786102 CAGTGAACACAGAGGAAGTTTGG - Intronic
1166466926 19:43040743-43040765 CAGTGAACACAGAGGAAGTTTGG - Intronic
1166473057 19:43096818-43096840 CAGTGAACACAGAGGAAGTTTGG - Intronic
1166486729 19:43220357-43220379 CAGTGAACACAGAGGAAGTTTGG - Intronic
1166493839 19:43283805-43283827 CAGTGAACACAGAAGAAATTTGG - Intergenic
1167200157 19:48059563-48059585 CAAAGCAGACAGAAGAAGGTGGG + Intronic
1167422593 19:49412987-49413009 CAGCGCACCCTGAAGAAGGAAGG + Exonic
1167919908 19:52774498-52774520 AAGAGAACACAAAACCAGGAAGG + Intronic
1168009354 19:53518138-53518160 CACAGAAGGCAGAAGAAGGTGGG + Intergenic
1168087660 19:54060265-54060287 AACAGAACACAGAAGAGGGAGGG - Intronic
1168173612 19:54607596-54607618 CACAGAACACACACAAAGGAAGG - Intronic
1168296528 19:55379728-55379750 CAGTGAAGACAGAAGGAGGCCGG + Intronic
1168333770 19:55585564-55585586 CAGAGAGCACAGCACATGGAAGG + Intergenic
924961494 2:38708-38730 GAGAGAACACTCAAGAAGAAAGG + Intergenic
925530283 2:4851859-4851881 CAGAGAACATAGAATAAGCGTGG + Intergenic
925663883 2:6232306-6232328 CAGAGAGCACAGAGGAAAGGAGG - Intergenic
925732927 2:6935091-6935113 CAGAGAAGAAGGAAGAGGGATGG - Intronic
926188897 2:10712557-10712579 CAGAGAGCACAGATGAAGGGCGG + Intergenic
926757549 2:16248554-16248576 CAGGGAACCCAAAAGCAGGAAGG + Intergenic
926897439 2:17709711-17709733 CAGAGAATAAAGAAAAAGAAGGG + Intronic
926935388 2:18082618-18082640 CAGGGAACAAGGAACAAGGAAGG - Intronic
926957831 2:18320966-18320988 GAGAGAACACAAAAGAAGCATGG - Intronic
927225350 2:20759716-20759738 CAGAGAAGACATAACAGGGAGGG - Intronic
927515600 2:23670068-23670090 CTGAGAACCCAGATGCAGGAAGG - Intronic
928070348 2:28208895-28208917 CAAGGAACAAAGAAGAAAGACGG - Intronic
928254152 2:29707430-29707452 CAGGGAAAACAGAACAAGGGAGG + Intronic
928414663 2:31082232-31082254 CAGATAACACACAACAAGCAGGG + Intronic
929072206 2:38043575-38043597 CAGAGAAGGCAGAAGAAGAGGGG - Intronic
929113914 2:38428488-38428510 AAGAAAAAATAGAAGAAGGAGGG - Intergenic
929861260 2:45679790-45679812 GAGGGAACACAGAAGAAGGAAGG - Intronic
929995826 2:46825772-46825794 CGGAGAACACTCGAGAAGGAAGG - Intronic
930000740 2:46859983-46860005 CAGTGACCCCAGAAGGAGGAAGG + Intergenic
930280539 2:49363435-49363457 TGGAGAACACAGAAGAAGATAGG - Intergenic
930294040 2:49530929-49530951 CAGAAGGCTCAGAAGAAGGAGGG - Intergenic
930397955 2:50847204-50847226 AAAAGAACACTGAAGTAGGAAGG - Intronic
931588175 2:63851833-63851855 AAGATAGCACAGCAGAAGGAAGG - Intronic
931631081 2:64300120-64300142 AAGACAACACAGTAGAAAGAAGG + Intergenic
931665750 2:64608885-64608907 AAAAAAAGACAGAAGAAGGAAGG + Intergenic
931866773 2:66421343-66421365 CCAAGAAGACAGAAGTAGGATGG + Intergenic
931918562 2:66986957-66986979 CAGATACCACAGAAAAATGATGG + Intergenic
932492368 2:72130563-72130585 TCGAAAACACAGAAGAATGAAGG - Exonic
932542038 2:72665016-72665038 CTGAGAACACTGAAGAGGGGTGG + Intronic
932584979 2:73022071-73022093 CAGAGAACAGAGAATTAGGCTGG + Intronic
932857629 2:75253873-75253895 TAGAAAAGACAGAAGAAGGTTGG - Intergenic
934053562 2:88232302-88232324 CAGAGAACTTAGAGGAGGGATGG - Intergenic
934059721 2:88282998-88283020 CAGAGCACACAGAATGAGGTGGG - Intergenic
934109331 2:88727171-88727193 CAGAGAACGCTGCAGAGGGAGGG - Intronic
935202577 2:100870734-100870756 CAGACAACATGGAAGAAGAAGGG - Intronic
935231179 2:101098056-101098078 CAGAGAAGGCAGAAAAAGAAAGG + Intronic
935921042 2:108015436-108015458 AAGAGAATACAGTAGAAGGATGG + Intergenic
936108805 2:109648234-109648256 CAGAGAACTCAAAGGCAGGAAGG + Intergenic
936499860 2:113058684-113058706 CAGGAAAGACAGAGGAAGGAAGG + Intronic
936660559 2:114538260-114538282 CAGAGAAGAAAGAAGAGGAAAGG + Intronic
937112904 2:119380396-119380418 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
937227251 2:120377064-120377086 CAGAGAGAACAGAAGAGGAAAGG - Intergenic
937284759 2:120743293-120743315 CAAAGGACAAAGAAGCAGGAAGG - Intronic
937349979 2:121154625-121154647 CAGAGGACACACAGCAAGGAGGG + Intergenic
937603461 2:123768418-123768440 AAGAGAACAGAGGAGAAGAAAGG - Intergenic
937783905 2:125873105-125873127 CACACAACACAGATGAATGAGGG + Intergenic
937912203 2:127081167-127081189 CACCGAACCCAGAAGGAGGAAGG + Intronic
938045278 2:128113581-128113603 AAGAGAAAACAGAAGAAAAAAGG - Intronic
938261148 2:129895891-129895913 CAGGGCACACAGAGGAAGGAAGG + Intergenic
939469403 2:142600480-142600502 AAAAGATCACAGAAGAAAGAAGG - Intergenic
939887946 2:147701684-147701706 CAGAAAGCAAAGAAGAAGCAAGG + Intergenic
940660857 2:156543585-156543607 CTGGAAACACAGAAGAGGGAAGG + Intronic
940728079 2:157358185-157358207 CAGAGAAGTGAGAAAAAGGATGG + Intergenic
941404026 2:165066689-165066711 TAGAGAAAACAGAAAAAGGAAGG + Intergenic
941724457 2:168845967-168845989 GAGAGAACTCAGAGGAAGGTGGG - Intronic
941799223 2:169637001-169637023 CAGAGATCGCAGCAGAAGCAAGG + Exonic
942030969 2:171958582-171958604 CATAAAACACAGGAGAAGGCTGG - Intronic
942091239 2:172493441-172493463 CAGAGAACACTTTAGAGGGAAGG + Intronic
942473331 2:176286422-176286444 TTGAAAACACAGAAAAAGGAAGG - Intronic
943395263 2:187325619-187325641 CAGAACACAAAGACGAAGGATGG - Intergenic
943761175 2:191611015-191611037 CAGAGAACACAGAGAAATAATGG + Intergenic
944136564 2:196406082-196406104 CAGTGTACACAGAGAAAGGAAGG - Intronic
944364277 2:198898264-198898286 AAGAAAAGAGAGAAGAAGGAAGG + Intergenic
944374533 2:199026576-199026598 CCCTGAACACAGAAGAAGGAGGG - Intergenic
944619386 2:201498447-201498469 CAAAGCAGACAGAGGAAGGAGGG - Intronic
945020169 2:205562835-205562857 CAGAGAAGACAGGAGGAGGTAGG - Intronic
945810746 2:214547041-214547063 CAGAGAGCAAAGTACAAGGATGG + Intronic
945965751 2:216184881-216184903 CAGGGCATACAGAAGAAGGGAGG - Intronic
945991683 2:216400838-216400860 CAGGGAATACAGAATCAGGAAGG - Intergenic
946056091 2:216903187-216903209 CAGAGGACTCAGAAGAAGGCAGG - Intergenic
946359932 2:219213169-219213191 CAGAGCACTGAGAAGCAGGAAGG + Intronic
946566762 2:220974126-220974148 GAAAGAAAACAAAAGAAGGAGGG + Intergenic
946907578 2:224431187-224431209 GAGAAAATGCAGAAGAAGGAAGG + Intergenic
947387621 2:229607494-229607516 CAGAAAACAAAAAAGAAGCATGG - Intronic
947481759 2:230507137-230507159 CTCAGAAGACAGAAGCAGGAGGG + Intronic
947502169 2:230679107-230679129 CAAAGAATAAAGAAGAAGGTAGG + Intergenic
947575325 2:231269279-231269301 GAGAGAACACAGAAAACAGAGGG - Intronic
947615487 2:231554470-231554492 CTGAGTACACAGACGAAGGAAGG - Intergenic
947734293 2:232446734-232446756 CAGGGGACACAGAAGAGGGCAGG - Intergenic
947922677 2:233891900-233891922 CAGATAACACAAAAGAAAAATGG + Intergenic
1168858745 20:1029518-1029540 CAGAGAACCCTGCAGATGGAAGG + Intergenic
1169648657 20:7842659-7842681 CTTAGAAGACAGAAGAAAGAGGG - Intergenic
1170505841 20:17024959-17024981 CAGAGAAAGCAGAAGAAGGTGGG + Intergenic
1170928481 20:20747033-20747055 TAGAGAACTCAGAAGAATAAGGG + Intergenic
1171045821 20:21808886-21808908 CCCAGAACACAGGAGAAGAAGGG + Intergenic
1171465684 20:25326144-25326166 AAGAGAAGAGAGAGGAAGGAAGG + Intronic
1172782913 20:37447783-37447805 CAGAGGAAACAGGAGAAGGGTGG - Intergenic
1173027723 20:39325039-39325061 CAGAGGTCTCAGAGGAAGGAAGG + Intergenic
1173205660 20:40991221-40991243 CAGACAACAAAGAAGAAAAATGG - Intergenic
1173428670 20:42966387-42966409 GAGGGAACACAGAGGAAAGAGGG - Intronic
1173513646 20:43649732-43649754 CAGAGGACAGGGAAGAAGCATGG - Intergenic
1173639703 20:44592332-44592354 CAGAGGACACAGAGGAATCAAGG + Intronic
1173964361 20:47100626-47100648 CAGAGATCACACAGGAAGGCAGG - Intronic
1174013428 20:47469188-47469210 CAGAGAAAACAACAGAGGGAGGG + Intergenic
1174102359 20:48137407-48137429 CTGGGACCACAGAGGAAGGAGGG - Intergenic
1174370854 20:50086318-50086340 CACTAAACACAGAAAAAGGAGGG + Intronic
1174562260 20:51439624-51439646 CAGAGAACACTGGAGAGGGCAGG - Intronic
1174718180 20:52782973-52782995 AAGAAAACACAGAAGCAGCAGGG - Intergenic
1174809841 20:53636287-53636309 GAGAGAGGAAAGAAGAAGGAAGG + Intergenic
1175034895 20:55991036-55991058 CACATGACACAGAAAAAGGAAGG + Intergenic
1175295674 20:57907323-57907345 CAGAGACCACAGGTGAAGGCAGG - Intergenic
1175432467 20:58915657-58915679 CTAAAAAGACAGAAGAAGGAAGG - Intergenic
1175880774 20:62257511-62257533 CAGAGAACACAGAACCACCATGG - Intronic
1176193324 20:63824626-63824648 CAGAGCACCCAGAAGAACGGGGG - Intronic
1176431246 21:6577691-6577713 AAAAGAACACAGAACAAGAAAGG - Intergenic
1176920605 21:14683603-14683625 AAGAGAGGAGAGAAGAAGGAAGG + Intergenic
1177752255 21:25298743-25298765 CAGAACACACAGAAGAAGTAGGG + Intergenic
1177801108 21:25829898-25829920 CAGAACACCCAGAAGAAGGAAGG - Intergenic
1178259475 21:31085600-31085622 CAGAGAAAAAGAAAGAAGGAAGG + Intergenic
1178450344 21:32692642-32692664 GAAAGCACACAGGAGAAGGAAGG + Intronic
1178505271 21:33157458-33157480 GAGAGAAGAGAGAGGAAGGAAGG - Intergenic
1178579775 21:33828622-33828644 CAGAAAAAAAAGAAGAAAGAGGG - Intronic
1178851935 21:36219856-36219878 GAGAGAACAGAGAAAATGGAGGG + Intronic
1178943309 21:36925566-36925588 CAGAGGAAGCAGAAGAAGGTGGG - Intronic
1179353433 21:40635160-40635182 CAGACAAGGCAGAAGAAAGAAGG + Intronic
1179669294 21:42934584-42934606 CAGCTAAGACAGAAGAAAGATGG + Intergenic
1179706640 21:43185153-43185175 AAAAGAACACAGAACAAGAAAGG - Intergenic
1179730989 21:43367377-43367399 CAGAGAAGCCAGAAGAGGCAAGG + Intergenic
1179782468 21:43710617-43710639 GAGAGAAAACAAAGGAAGGAAGG + Intergenic
1180223119 21:46372466-46372488 CCCAGAACACAGAAGCAGGAGGG - Intronic
1180499999 22:15922412-15922434 CAGAGGACACAGAAGGAGGGAGG - Intergenic
1180715581 22:17869927-17869949 CAGAGAACAAAGAATAAGCTGGG - Intronic
1180729280 22:17969535-17969557 CAGGGAAGAAGGAAGAAGGAAGG - Intronic
1180798613 22:18620595-18620617 CAGAGAATGGAGTAGAAGGAAGG + Intergenic
1180831930 22:18910972-18910994 CAGAGCACACTGGAGAAGGCGGG + Exonic
1181067915 22:20315370-20315392 CAGAGCACACTGGAGAAGGCGGG - Exonic
1181074259 22:20364520-20364542 CAGAGCACACAAGAGATGGAAGG + Intronic
1181223103 22:21374669-21374691 CAGAGAATGGAGTAGAAGGAAGG - Intergenic
1181255635 22:21560965-21560987 CAGAGAATGGAGTAGAAGGAAGG + Intronic
1181642181 22:24208066-24208088 CAGAGAACAGAAAAGAGGAAAGG - Intergenic
1181671925 22:24429608-24429630 CAGAGAGCACAGCAGCAGGAAGG - Intronic
1181975500 22:26726467-26726489 CAAAGAACACAGACAAAGGAGGG + Intergenic
1182647320 22:31820821-31820843 CAGGGAACCCTGATGAAGGAGGG - Intronic
1182651373 22:31853981-31854003 CAGCCTACACAGAAGCAGGAAGG - Intronic
1183430767 22:37764278-37764300 CAGAAAACACAGAAAAGGTAGGG - Intronic
1184001164 22:41674670-41674692 CAGAGCAGACAGAAGCAGGGTGG - Exonic
1185220213 22:49625687-49625709 CAGAGAAGGCAGAAAAAGAATGG + Intronic
1203282008 22_KI270734v1_random:136243-136265 CAGAGCACACTGGAGAAGGCGGG + Intergenic
949504078 3:4710422-4710444 CAGAGAACACAGACGCCAGAAGG + Exonic
950823140 3:15784576-15784598 CACAGAAGGCAGAAGAAGAATGG + Intronic
951431946 3:22618394-22618416 AAGAGGAAAGAGAAGAAGGAAGG + Intergenic
952505317 3:34001987-34002009 CAGTGAACACAGAACTAGGCTGG - Intergenic
952553428 3:34504642-34504664 TGGAGAACACAGAAGCAGGCAGG + Intergenic
952748974 3:36809062-36809084 CAGAGAAGACTGAACAAAGAAGG + Intergenic
953419956 3:42746843-42746865 CAGATAGCAGAGAAGAAGGCAGG + Intronic
953494302 3:43373037-43373059 CAGAAAACACACCAGTAGGATGG + Intronic
954625020 3:52017724-52017746 CAGAGCCCACAGCAGAGGGAAGG - Intergenic
954876696 3:53807073-53807095 CTGAGAACACAGGTGGAGGAGGG - Intronic
955149425 3:56352366-56352388 CAAAGAAGACAAAAGAAGAATGG + Intronic
955307473 3:57848655-57848677 AAGAGGAAAAAGAAGAAGGAAGG - Intronic
955321099 3:57974917-57974939 CAGATAACTCACAGGAAGGAAGG + Intergenic
955506116 3:59634872-59634894 CAGAAAACACAGAAGTAGGGTGG - Intergenic
955613305 3:60780234-60780256 GAGAGAACAGAGGAGAAGAAAGG - Intronic
955929682 3:64044212-64044234 CATAGAATAAAGAACAAGGAAGG - Intergenic
956639353 3:71400910-71400932 AGGAGAACACATAAGGAGGAGGG + Intronic
956734617 3:72228613-72228635 TAGAGAACAGGGAAGAAGGAAGG + Intergenic
956860550 3:73319540-73319562 CAGAAAAGACAGTAGAAGAAGGG + Intergenic
956863698 3:73349132-73349154 CAGTGAAGAAAGAAGTAGGATGG + Intergenic
956971532 3:74532008-74532030 CAGAAAAAACAGGAGAAGGAGGG + Intergenic
957146591 3:76432834-76432856 GAGAGAAAAAAGAGGAAGGAAGG + Intronic
957576385 3:82013989-82014011 TGGAGAACTCAGAAGAAGGTAGG + Intergenic
957612289 3:82483743-82483765 GAGAGAACAGAGAAAAAGGTAGG + Intergenic
958842839 3:99229039-99229061 CAGAGGAATCAAAAGAAGGAAGG + Intergenic
959512243 3:107226807-107226829 CAGAGGAGACACAGGAAGGAAGG + Intergenic
959979588 3:112500824-112500846 CTGTGAACACAGGAAAAGGAAGG - Intergenic
960012805 3:112851602-112851624 CAGAAAACAGAAAAGAAGCAGGG + Intergenic
960267830 3:115640974-115640996 AATAGAAGAAAGAAGAAGGAAGG - Intronic
960794808 3:121474211-121474233 CAGAAAACACTAAAGTAGGAAGG + Intronic
961964256 3:130886533-130886555 CAGAGAAGACAAAAGAAATAAGG - Intronic
962432616 3:135333858-135333880 GAGAGAACAGAGAAAATGGAAGG - Intergenic
962433678 3:135345375-135345397 CTGAGAGCAGAGAAGGAGGATGG + Intergenic
963077117 3:141357245-141357267 CAAACAACACACAAGAAAGAGGG - Intronic
963404691 3:144847486-144847508 CAGAGACAATGGAAGAAGGAAGG + Intergenic
964342076 3:155718310-155718332 TAGAGGGCTCAGAAGAAGGAAGG - Intronic
964898543 3:161628481-161628503 CAGAGAGCAAAGAGAAAGGAAGG - Intergenic
965117368 3:164508486-164508508 GAGAGAAAACAGAAGAAAGAAGG - Intergenic
965510607 3:169564938-169564960 AAGAGAACTTTGAAGAAGGATGG + Intronic
965602377 3:170467984-170468006 GAGAGCACACAGAAGAAAGCAGG - Intronic
965798936 3:172471247-172471269 CAGGGATCACAGATGAAGGACGG + Intergenic
965910788 3:173772788-173772810 CAGTGAATACAGAAAAAGGATGG - Intronic
966210918 3:177452482-177452504 GAGAGAAAAAAGAGGAAGGAAGG - Intergenic
966264451 3:178022303-178022325 AAGAAAAGACAGGAGAAGGAGGG - Intergenic
966827354 3:183976206-183976228 AAGAGAAGAAAGAAAAAGGAAGG - Intronic
966945177 3:184772814-184772836 AAGAGAAGAGAAAAGAAGGAAGG + Intergenic
966956497 3:184885822-184885844 CAGAGGGAGCAGAAGAAGGAGGG - Intronic
967490763 3:190088619-190088641 CAGAGACCAGATCAGAAGGAGGG + Intronic
967526413 3:190499333-190499355 CACAGAAAACAGAAGAGGAAGGG - Intergenic
967676481 3:192305058-192305080 CAGAGAAGGGAGAGGAAGGAGGG + Intronic
967760765 3:193224045-193224067 CAGAGAACAAAGAAGATGAATGG - Intergenic
967826573 3:193882079-193882101 CCGGGAACAAAGGAGAAGGATGG - Intergenic
968476429 4:811770-811792 CAAAGGACAGAGAAGCAGGAAGG - Intronic
968682533 4:1931062-1931084 AAGAGAGGACACAAGAAGGAAGG + Intronic
969042207 4:4307904-4307926 CAGAGAAAGCATGAGAAGGATGG - Intronic
969165882 4:5312014-5312036 GAGAGAAGAATGAAGAAGGATGG - Intronic
969202582 4:5617733-5617755 CAGAGAAAACAGAAGTTCGAAGG + Intronic
969361919 4:6669935-6669957 CAGAGAACATGGATGAATGAAGG + Intergenic
969489456 4:7490857-7490879 CAGAGGGCACAGAGGAAGCAGGG - Intronic
970293057 4:14597587-14597609 CAGAGCTCAGAGAAGAAAGAAGG - Intergenic
970365211 4:15351258-15351280 AGGAGAAAACAGAGGAAGGAAGG - Intronic
970450989 4:16166263-16166285 CAGAGAAAACAAAAGCAGGACGG - Intronic
970531409 4:16989230-16989252 CAGTTAACTTAGAAGAAGGAAGG - Intergenic
970548373 4:17153513-17153535 GAGAGAACACAGGAAAAGGCAGG + Intergenic
970589015 4:17542834-17542856 TAGAGATAACAGAAGAATGAAGG + Intergenic
970938699 4:21605979-21606001 AAGAGAAAACAACAGAAGGAAGG - Intronic
970959823 4:21858334-21858356 AAGAGAACAAAGAAGAAAAATGG + Intronic
971812503 4:31444808-31444830 CAGAGAACAGGGTAGAAGAATGG + Intergenic
972330043 4:38056135-38056157 CAGAGACCAGAGAAGAAGCCAGG - Intronic
972770056 4:42189417-42189439 CAGAGAAAAGAGGATAAGGAGGG - Intergenic
972895751 4:43617797-43617819 CAGAAAACATAGAAGAACAAGGG + Intergenic
974241849 4:59259412-59259434 CAGAGAACAAAAGAGAGGGAAGG - Intergenic
974331574 4:60486180-60486202 CAGAGAACACCAAACATGGAGGG - Intergenic
974471200 4:62320077-62320099 CAGAGGACATAGAGGAAAGAAGG + Intergenic
974800214 4:66807660-66807682 CTGACAAGACAGCAGAAGGAAGG + Intergenic
974963822 4:68735969-68735991 GAGAGAACAGAGGAGAAGAAAGG + Intergenic
975379713 4:73685014-73685036 GAGAGGACACAGAAGCAGGAAGG + Intergenic
975965992 4:79973075-79973097 CAAAGATAAAAGAAGAAGGAAGG + Intronic
975967592 4:79993352-79993374 GAGAGAATAAAGAAGGAGGAAGG + Intronic
976093809 4:81486628-81486650 CAGAGCACACAGAAGGAGGGAGG + Intronic
976143244 4:82015173-82015195 GAAAGAAGACAGAAGAAGAAAGG + Intronic
976499402 4:85770137-85770159 CAAAGAATACAGACCAAGGAAGG + Intronic
977178274 4:93840921-93840943 CAGGGAACACAGCAGAGGCAGGG + Intergenic
977287018 4:95120658-95120680 AAGAAAAGAAAGAAGAAGGAAGG - Intronic
977851451 4:101835095-101835117 AATAGAAGACAGAAAAAGGAAGG - Intronic
978264736 4:106810242-106810264 GAGAGAAGAAAGAAGAAAGAAGG - Intergenic
978478148 4:109155886-109155908 AAGAGAACAAAGCAGAAGTAAGG + Intronic
978653117 4:111031999-111032021 CAAAGCACGGAGAAGAAGGAGGG + Intergenic
978662234 4:111140722-111140744 TAGAGAACACAAAAGAAAGATGG + Intergenic
979245473 4:118499016-118499038 CATAGAACTCAGAGGAAGGCAGG + Intergenic
979384063 4:120042865-120042887 CAGAAAAAACAGAAAAATGAAGG - Intergenic
979407093 4:120326483-120326505 AAGAGAAGAAAAAAGAAGGAAGG + Intergenic
979549926 4:121979228-121979250 CAGAGAAAAAAGTAGAGGGAAGG + Intergenic
979774983 4:124579210-124579232 CAAAGACCAGAGAAAAAGGATGG + Intergenic
980647608 4:135662736-135662758 CAGAAAACAAAGAAGAAGCAAGG - Intergenic
980967714 4:139539179-139539201 AAGGGAACACAGTGGAAGGAAGG - Intronic
981235678 4:142412669-142412691 CAGAGAATACAGAAGAAAGATGG - Intronic
981491915 4:145348679-145348701 CAGAGCCCACAGAAGGAGAATGG - Intergenic
982138949 4:152299215-152299237 CAGAGCACACTGAAGAATGCTGG + Intergenic
982779780 4:159479057-159479079 CAGAGACCAAAGAAGAGGTATGG + Intergenic
983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG + Intergenic
984189579 4:176589354-176589376 AAGAGTACAGAGCAGAAGGAAGG + Intergenic
984405311 4:179321548-179321570 CAGAGAAAAAAGAAAAAGGAAGG - Intergenic
984850062 4:184144978-184145000 CAGAGGGCACTGAGGAAGGAAGG + Intronic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985051871 4:185999251-185999273 TTGAGAGCACAGAAGCAGGAGGG + Intergenic
985723395 5:1502416-1502438 CAGAGAAGACGGCAGAATGAAGG + Intronic
985823470 5:2176658-2176680 CAAGGAACAAAGAAGAAAGATGG - Intergenic
986143543 5:5054686-5054708 AAAAGAAGAAAGAAGAAGGAAGG + Intergenic
986283831 5:6345593-6345615 CAGAGAACAGAGGAGGAGGGAGG + Intergenic
986446021 5:7822014-7822036 CGGAGAAAAGTGAAGAAGGAAGG + Intronic
986968346 5:13302455-13302477 CAAGGAACAAAGAAGAAGTACGG + Intergenic
987017667 5:13836863-13836885 GACACAAGACAGAAGAAGGAGGG + Intronic
987075897 5:14381428-14381450 CAAAGGACACAGATGAAGGGAGG - Intronic
987390950 5:17375163-17375185 CAGAGACTACAAAAGAAGGGTGG - Intergenic
987793077 5:22593408-22593430 CAGGGAAAACAGGAGAAAGAAGG - Intronic
987962772 5:24831934-24831956 CAGAGAACACAGCAGGAGCTAGG - Intergenic
988185746 5:27859359-27859381 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
988457386 5:31398471-31398493 CTGAGAACTCAGAAGAACCAGGG - Intergenic
988628385 5:32901481-32901503 CAGAGAGCTCAGAAGAAGACAGG - Intergenic
989112745 5:37922969-37922991 CTGAGAACTCAGAAGGAAGAAGG - Intergenic
989299765 5:39876976-39876998 CAGAGAAAAAAGAGGAAGGAGGG + Intergenic
990626265 5:57614949-57614971 GAGAGAACAGAGCAGATGGATGG + Intergenic
990804813 5:59647615-59647637 CAGATAAGACTGAAGAAGGATGG + Intronic
991471603 5:66975127-66975149 CAGAGAAGCCAGAAGATGCAAGG + Intronic
991515245 5:67427969-67427991 GAGAGAAGAGAGAGGAAGGAAGG - Intergenic
992197719 5:74356297-74356319 CAGAGAATAAAGAAAAAAGAAGG + Intergenic
992314431 5:75537434-75537456 CAGAGAGCACGGAGGAATGAAGG - Intronic
992530591 5:77648205-77648227 CAGAGAACAATAAAGAAGGCTGG - Intergenic
992543524 5:77786995-77787017 TAGAAAGCACAGAATAAGGAAGG - Intronic
993361711 5:86984964-86984986 CAGAGAGCAGAGAAGAGGAAAGG + Intergenic
993524965 5:88954073-88954095 CAGACAGCACAGAGGAGGGAGGG - Intergenic
993576340 5:89606063-89606085 CAGAGATCACTTTAGAAGGAAGG + Intergenic
993628085 5:90250196-90250218 AAGAGACGACAGAAAAAGGAAGG - Intergenic
993863430 5:93163550-93163572 AAATGAACACAAAAGAAGGAGGG + Intergenic
994057456 5:95434348-95434370 CATGGAAAACACAAGAAGGAAGG - Intronic
994655617 5:102590006-102590028 CAGATCTCACAGAAGATGGAAGG + Intergenic
994918619 5:106012337-106012359 CAGAGGGCTCAGAAGAAGGTAGG - Intergenic
994936598 5:106260772-106260794 AAGAGGAGACAGAAGAAGAAAGG - Intergenic
996287746 5:121814583-121814605 AAGAAAACCCAGTAGAAGGATGG + Intergenic
996342893 5:122457646-122457668 CAGAGAACACAGAACACCTAAGG - Intronic
996349371 5:122521590-122521612 TATAGAAGGCAGAAGAAGGAAGG - Intergenic
996547903 5:124700101-124700123 CAGAGAACAAAGAAAAATGAAGG - Intronic
996561361 5:124833079-124833101 TTGAAAACACAGAAAAAGGAAGG - Intergenic
996923594 5:128797279-128797301 AAGAGAAAAAAGAAGAAGAAAGG - Intronic
997109563 5:131059917-131059939 TTGAGGACACAGAAAAAGGATGG - Intergenic
997333068 5:133081392-133081414 CAGTAAACACAAAAGAGGGAGGG - Intronic
997506539 5:134422019-134422041 AAGAGAAAGGAGAAGAAGGAAGG - Intergenic
997742397 5:136268454-136268476 TAGAGACCACAGATAAAGGATGG - Intronic
997880801 5:137587734-137587756 TACAGGAGACAGAAGAAGGAAGG - Intronic
998418263 5:141960820-141960842 AAGGGAACAGAGAAGAGGGAGGG + Intronic
998495822 5:142588469-142588491 GAGAGAAGAGAGAAGAGGGAGGG - Intergenic
998547598 5:143044297-143044319 ATGAGAAGCCAGAAGAAGGAAGG - Intronic
998894346 5:146782807-146782829 GAGAGGAAACAGAAGAAAGAAGG + Intronic
999343300 5:150792361-150792383 CAGTGAACTCACTAGAAGGAGGG + Intronic
999678733 5:154034717-154034739 CACAGACCACAGAAAAAGTAGGG - Intronic
1000018088 5:157296104-157296126 CACAGAACTGAGAAAAAGGAAGG + Intronic
1000332556 5:160217387-160217409 CAGAGAAAAGACAAGAAGAAGGG + Intronic
1001108390 5:168875212-168875234 GAGGGAAGAGAGAAGAAGGAAGG + Intronic
1001220459 5:169895905-169895927 CAGAAAATAGGGAAGAAGGAAGG - Intronic
1001415017 5:171539610-171539632 CAAAGCAGACAGTAGAAGGAAGG - Intergenic
1001946259 5:175780770-175780792 CTCAGAACACAGAGAAAGGATGG - Intergenic
1001992692 5:176131406-176131428 CAGAGTACAGACAAAAAGGAAGG - Intronic
1002002412 5:176204872-176204894 CAGAGTACAGACAAAAAGGAAGG - Intergenic
1002080890 5:176736735-176736757 CAGGGAGGACAGGAGAAGGAAGG - Intergenic
1002213993 5:177616260-177616282 CAGAAAAGACAGAAAAAGAAGGG - Intergenic
1002224186 5:177706739-177706761 CAGAGTACAGACAAAAAGGAAGG + Intergenic
1002286128 5:178163946-178163968 GAGAGGACAGAAAAGAAGGAAGG + Intergenic
1002518382 5:179775707-179775729 CAGAGAAAACTGCAGAAGGTGGG - Exonic
1002771674 6:295420-295442 CAGATTATACAGAAGATGGAGGG + Intronic
1002905903 6:1449070-1449092 CAAAGGAGACAGCAGAAGGATGG - Intergenic
1002937680 6:1687553-1687575 CCTGGAACACAGGAGAAGGACGG - Intronic
1003495618 6:6660857-6660879 CCCAGAACACAGAGGACGGAAGG + Intergenic
1004042450 6:11993889-11993911 GGGAGAAAACAGAAGCAGGAGGG + Intergenic
1004351279 6:14892382-14892404 CAGAGAACAATGAGTAAGGATGG - Intergenic
1004576963 6:16905857-16905879 AGTAGAACACAGAAGAGGGAAGG - Intergenic
1004657480 6:17677848-17677870 CAGAAAACACGAAAGAAGAAAGG - Intronic
1004885375 6:20046312-20046334 CAGAGGACACAGAAAATGTATGG - Intergenic
1004929383 6:20447127-20447149 CTCTGAACACAGAGGAAGGAGGG + Intronic
1005159596 6:22843595-22843617 CAGAGGGCAAAGAGGAAGGAGGG - Intergenic
1005237707 6:23784814-23784836 CAGAGAACACAGAGCACGCAAGG - Intergenic
1005427994 6:25723951-25723973 CAGAAATGACAGAATAAGGAAGG + Intergenic
1005493131 6:26365306-26365328 CAGAGCCCACAGAATAAAGACGG - Exonic
1006101394 6:31688309-31688331 CAGAGAACAGAGCAGTGGGAAGG + Intronic
1007221823 6:40284687-40284709 CAGAGCAGAAAGGAGAAGGAAGG - Intergenic
1007422843 6:41729853-41729875 CACAGAACCCAGGAGAAGGACGG + Intronic
1007982804 6:46176333-46176355 AAGTGAAAACAGAAAAAGGAAGG + Intergenic
1008167025 6:48151185-48151207 CAGAGCACAGAGAGGAAGCATGG + Intergenic
1008688905 6:53956063-53956085 CAGAGAACACAGAACCCAGAGGG - Intronic
1009866148 6:69399998-69400020 CAGAGAAAAAAAAAGAAGAATGG + Intergenic
1010288378 6:74106755-74106777 CAAAGAACACAGGCTAAGGAAGG + Intergenic
1011092714 6:83624540-83624562 CAGAGAAGAAAGAGGAAAGAAGG - Intronic
1011733260 6:90287964-90287986 AAGTGAGCACAGAAGGAGGATGG + Intronic
1012070311 6:94605416-94605438 CAGAGGGCTCAGAAGAAGAAAGG - Intergenic
1012085164 6:94815732-94815754 TAGAGAACAAAGAAGATGTATGG + Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012431600 6:99169984-99170006 CAGAGTAGATAGAATAAGGAGGG - Intergenic
1012646189 6:101684983-101685005 GAGAAGACACAGAAGCAGGAAGG - Intronic
1012767376 6:103386097-103386119 TAGAGAACTCAGAAGAAGATAGG + Intergenic
1012868222 6:104643128-104643150 CACAGAACTCAGAGGAAAGATGG + Intergenic
1014717434 6:124882730-124882752 GAGAGAAAAAAGAAAAAGGAAGG + Intergenic
1015285499 6:131482148-131482170 AAGAAAAGAAAGAAGAAGGAAGG - Intergenic
1015602952 6:134928230-134928252 CTGAGAAAACAGAAGAAATAAGG + Intronic
1016342310 6:143076649-143076671 CAAATAACCCAGAAGAAGGCAGG - Intronic
1016544138 6:145201700-145201722 GAAAGAAGAAAGAAGAAGGAAGG - Intergenic
1016756759 6:147696128-147696150 CAAAGAGCACAGAAGAAGTAGGG - Intronic
1017124474 6:151052460-151052482 CAAGGGATACAGAAGAAGGATGG + Intronic
1017492987 6:154960269-154960291 CAGAGGTCTCAGAAGAAGGGAGG - Intronic
1017502415 6:155037850-155037872 CAGTGGACACAGAAGAAGTAAGG - Intronic
1017945810 6:159095550-159095572 CAAAGAACAGGGAAGAAGGACGG + Intergenic
1018141452 6:160841526-160841548 CAGTGAACCCAGAAAAACGACGG - Intergenic
1018471228 6:164100375-164100397 CTGGGACCACAGGAGAAGGAAGG - Intergenic
1018581898 6:165315142-165315164 GAGAGAACAGAGAGGCAGGAGGG - Intergenic
1019035981 6:169059000-169059022 CATAGAACAAAGAAGAAAGGTGG - Intergenic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019406570 7:887162-887184 CAGAGCACAGCGAGGAAGGAAGG - Intronic
1020433231 7:8134406-8134428 ATTAGAACACAGAAGATGGAAGG + Intronic
1020468886 7:8513093-8513115 AAGACATCATAGAAGAAGGAGGG + Intronic
1020918338 7:14227582-14227604 CACAGAAAATAGAAGAAGGAAGG + Intronic
1021163771 7:17308205-17308227 AAGAGAGAAAAGAAGAAGGATGG - Intronic
1021296022 7:18906984-18907006 AAGAGAAAACACAAGATGGAAGG + Intronic
1022109260 7:27218278-27218300 CATAGAACACAAATGAAGGATGG + Intergenic
1022232116 7:28424066-28424088 CAGAGAAGACAGAAGAAGGAGGG - Intronic
1022612183 7:31886893-31886915 AAGATAAAACAGAAGAAGGTAGG + Intronic
1022766797 7:33421929-33421951 CAGAAAATACAGAAAAGGGAAGG + Intronic
1023133019 7:37022391-37022413 CAGACAACCCAGTAGAAGAATGG + Intronic
1023540088 7:41255594-41255616 TAGAGGACACAGAAAAAGTAGGG - Intergenic
1023635150 7:42202261-42202283 GAGAGAACACAGACCAAAGAGGG - Intronic
1023728039 7:43164227-43164249 CAGAGAAGGCAGGAGGAGGAAGG + Intronic
1023871590 7:44266212-44266234 CTGAGAAGCCACAAGAAGGAGGG + Intronic
1023905286 7:44517367-44517389 CATGGCACACAGAAGATGGAAGG + Intronic
1023911998 7:44562912-44562934 CAAAGGATACAGAAGATGGAGGG - Intergenic
1024225730 7:47325434-47325456 CAGAGAACACTGCTCAAGGAAGG + Intronic
1024242726 7:47447995-47448017 CAGAGAAGACAGCAGGAGGCTGG + Intronic
1024386169 7:48754408-48754430 AGCAGAACACAGCAGAAGGAGGG + Intergenic
1024407020 7:48993558-48993580 CACATAAGAAAGAAGAAGGAGGG - Intergenic
1024663603 7:51522798-51522820 CAGAGAAAACAAAAAGAGGATGG - Intergenic
1024682009 7:51700382-51700404 CAGAAAAGACAGAAAAAGAATGG + Intergenic
1024859893 7:53826275-53826297 AAGAGAAAAGAAAAGAAGGAGGG + Intergenic
1024951073 7:54860846-54860868 CAGAGAGAACAGAGGAAGGGAGG + Intergenic
1025080831 7:55981060-55981082 AAAAGAACACAGAAGAAATAAGG - Intronic
1026178614 7:68019247-68019269 CAGAGAAGACATAAGTAGCATGG + Intergenic
1026509170 7:71013754-71013776 AAGAGAAAAGGGAAGAAGGAAGG + Intergenic
1026600925 7:71776658-71776680 CTGAGAGCAGAGAAGAAAGATGG + Intergenic
1026636671 7:72088719-72088741 GAAAGAAGAAAGAAGAAGGAAGG + Intronic
1027121406 7:75524844-75524866 CAGAGGAGAAGGAAGAAGGAGGG - Intergenic
1027367490 7:77473563-77473585 CACAGTACAGAGAAGAGGGAAGG + Intergenic
1027990916 7:85360121-85360143 CAGAGGACTCAGAAGAAGACAGG + Intergenic
1028714482 7:93948892-93948914 GAGAGAAAAAGGAAGAAGGAAGG + Intergenic
1028794584 7:94888782-94888804 CTCAGAACACAAAACAAGGAAGG + Intergenic
1028921370 7:96314082-96314104 GAAAGAAGAAAGAAGAAGGAAGG + Intronic
1029166928 7:98598751-98598773 CAGAGAACAATGAAAATGGAGGG - Intergenic
1030011572 7:105173728-105173750 CAGAGAACAGAAAAGGAGTATGG + Intronic
1030913166 7:115278362-115278384 CAAAGAACACTGAAGAAGGAGGG - Intergenic
1031526575 7:122828633-122828655 TAGAGAACCAGGAAGAAGGAAGG - Intronic
1032261689 7:130343119-130343141 AAAAGAAGAAAGAAGAAGGAAGG - Intergenic
1033442538 7:141393439-141393461 GAGAGATCAAAGAGGAAGGAAGG + Intronic
1033471267 7:141651680-141651702 CAGCTAACAGAGAGGAAGGATGG - Intronic
1033603359 7:142906702-142906724 AAGAGAATAAAGAAGAATGATGG + Intergenic
1033653792 7:143360822-143360844 GAGAGAAGACAGAAGATGGTGGG + Intronic
1033669995 7:143482563-143482585 GAGAGAAGAATGAAGAAGGATGG - Intergenic
1034031689 7:147773699-147773721 GAGAGTACAAAGAAGAAGGAAGG - Intronic
1034686038 7:152972328-152972350 CTGAGAGCACAGAGGCAGGAAGG + Intergenic
1035145312 7:156810204-156810226 CAGAGATCACAGGAGAAGACAGG + Intronic
1035245450 7:157559838-157559860 GAGAGAACACAGGAGAGAGACGG - Intronic
1035390581 7:158501610-158501632 CAGACAGCACAGCAGAGGGAGGG + Intronic
1035613926 8:988680-988702 CAGGGAACACATCAGATGGAAGG - Intergenic
1036057644 8:5275903-5275925 CAAAGGAAACAGAAGAAGGAAGG - Intergenic
1036090239 8:5657278-5657300 CAGAGAAGCCAGGTGAAGGAAGG - Intergenic
1036210995 8:6841399-6841421 CACAGCAGACAGAAGAGGGATGG - Intergenic
1036771575 8:11582044-11582066 CAAACAAAACAAAAGAAGGAAGG + Intergenic
1036934313 8:12986315-12986337 TGGAGAACAGAAAAGAAGGATGG - Intronic
1036978777 8:13445131-13445153 AAGAGAGCACAGAGGGAGGAAGG + Intronic
1036980555 8:13465565-13465587 CAAATAACCCAGAAGAAGAACGG - Intronic
1036990549 8:13588180-13588202 CAGAGAAAACAGATGAACAATGG + Intergenic
1037585075 8:20270543-20270565 CAGAGTAGAAAGAAGCAGGAAGG + Intronic
1037590552 8:20308391-20308413 CAGAGAAGACAGAGGAGAGATGG - Intergenic
1037656152 8:20885953-20885975 CAGAGAGAAGAAAAGAAGGATGG + Intergenic
1037731010 8:21524088-21524110 CAGAGAGCACAGGAGGAGAATGG - Intergenic
1037926655 8:22848738-22848760 CTGAAAACACAGCAGAAGAAAGG - Intronic
1038244933 8:25846709-25846731 CTGAGCACCCAGAAAAAGGAAGG - Intronic
1038372761 8:27010333-27010355 CAAAGAACACTGGAGATGGAGGG - Intergenic
1038679333 8:29652429-29652451 AAGAGAAGAAAGAGGAAGGAAGG + Intergenic
1039007842 8:33060490-33060512 CAGGGAACTCTGAAGCAGGACGG - Intergenic
1039320155 8:36420744-36420766 CAGATAACACAAAAAAAGGAAGG - Intergenic
1039741442 8:40386660-40386682 CAGAGAATAAAGGACAAGGAGGG - Intergenic
1039946095 8:42129770-42129792 AAGAGAAGAGAAAAGAAGGAAGG - Intergenic
1040737449 8:50526167-50526189 CAGAGAACACAGAAGAGTTCAGG - Intronic
1040800891 8:51338564-51338586 CAGAAAACACTGTAGGAGGATGG - Intronic
1041102960 8:54415146-54415168 CAGACAACACAGCTGGAGGAGGG - Intergenic
1041731708 8:61069420-61069442 AAGGGAAAACAGAGGAAGGAAGG - Intronic
1041744038 8:61186647-61186669 AAGAGAAGACAAAAGAAGGGAGG + Intronic
1041993884 8:64029483-64029505 CAGAGAACAAGGGAGCAGGAAGG + Intergenic
1042335599 8:67627093-67627115 CAAAGGACAGAGAATAAGGAAGG + Intronic
1042420991 8:68589420-68589442 GAGAGAAAATAAAAGAAGGAAGG + Intronic
1043277196 8:78413550-78413572 AAGAGAACAGAGAAGAATGGGGG - Intergenic
1044751211 8:95417463-95417485 CAAAGAACACAGAAGCAGCCTGG - Intergenic
1044763122 8:95543439-95543461 CAGAGAACAAGAAGGAAGGAAGG - Intergenic
1044923138 8:97186714-97186736 CAGGGAACAGAGAAGTACGAAGG + Intergenic
1045193726 8:99908760-99908782 CAGAGAGAAGAGAAGGAGGAGGG + Intergenic
1045544242 8:103113889-103113911 CAGCAAACACAGTAGAAGGGAGG + Intergenic
1045615656 8:103907515-103907537 CAGAGAAAAAAAAGGAAGGAAGG - Intronic
1045629062 8:104095260-104095282 CAGAAAACTAAGAAGAAGCAAGG - Intronic
1045884510 8:107079553-107079575 TAGAGGACCCAGAAGAAGAAAGG - Intergenic
1046073938 8:109294454-109294476 CAGAGATGACAGATGAAGGCAGG + Intronic
1046531521 8:115452030-115452052 GAGAGAACATAGGAGAAGAAGGG - Intronic
1046532044 8:115458708-115458730 CACAGAACACAGAATCAGCATGG + Intronic
1046547799 8:115673557-115673579 CAGACAACATGGAAGGAGGAAGG + Intronic
1047177644 8:122556593-122556615 AAGGGGACAAAGAAGAAGGAAGG + Intergenic
1047540609 8:125762076-125762098 GAGAGAAGTCAGAAGAGGGATGG + Intergenic
1047549061 8:125850070-125850092 GAGAGAAAAAAGAGGAAGGAAGG - Intergenic
1047621907 8:126616533-126616555 CAAAGAAAAGAAAAGAAGGAAGG - Intergenic
1048013048 8:130473946-130473968 GAGGGAACACAGAGGAAGGAGGG + Intergenic
1048194533 8:132321506-132321528 GAGAGCAAACAGAAGCAGGAGGG - Intronic
1048979665 8:139696619-139696641 CTGAGTACACAGAGGAGGGAGGG + Intronic
1049188028 8:141269355-141269377 AGGAGAGCAGAGAAGAAGGATGG - Intronic
1049288125 8:141787571-141787593 CAGAGAACAGAGAGGGAGGGAGG + Intergenic
1050492018 9:6198090-6198112 CAGAGAACACAGCTCTAGGAAGG - Intergenic
1050747374 9:8892036-8892058 CAGAGAAAAGAAAAGCAGGAAGG - Intronic
1050846977 9:10233336-10233358 CAGAGAACACAAAACAATGAAGG - Intronic
1051087143 9:13363054-13363076 TACAAAACACAGAAGCAGGAGGG + Intergenic
1051140055 9:13969161-13969183 CTGCGAACAGAGAAGAAGCATGG + Intergenic
1051214257 9:14779398-14779420 CAGAGAAGGAAGAAGAAAGAAGG + Intronic
1051672459 9:19525047-19525069 CAGAAATCACAGCAGAAGGTGGG - Intronic
1052313870 9:27096532-27096554 CAGAGAACTCAGAAGAAGACAGG + Intergenic
1052394620 9:27923927-27923949 TAGAGAACAGAGAACAAGGGTGG + Intergenic
1053146212 9:35713844-35713866 AAGAGAAAAAAGAAAAAGGAAGG + Intronic
1053209020 9:36211921-36211943 GGGAGAACACAGTTGAAGGAAGG - Exonic
1053216106 9:36271971-36271993 CAGAGAGAAAAGAACAAGGATGG - Intronic
1053371805 9:37567850-37567872 CTGAGGACGCAGAAGAGGGAAGG - Intronic
1053423591 9:37996733-37996755 AAGAGACTACAGTAGAAGGAGGG - Intronic
1054722194 9:68615304-68615326 AAAAGAACAGAGAAGAAGGTAGG + Intergenic
1055171945 9:73269257-73269279 CACCGAACAAAGAGGAAGGATGG + Intergenic
1055199002 9:73634156-73634178 CAGAGAACACTGAAGCAGGAAGG + Intergenic
1055486734 9:76763628-76763650 CAGAGAGCACAGGAGAGGCAAGG - Intronic
1055723311 9:79199771-79199793 CAGAGAAGACAGAGAATGGATGG + Intergenic
1055752492 9:79522284-79522306 CACAGAACATAGAAGTTGGATGG + Intergenic
1055780482 9:79815757-79815779 CAGAGAACTGTGAAGAATGAAGG + Intergenic
1056212661 9:84379671-84379693 GAAAGAAAAAAGAAGAAGGAAGG - Intergenic
1056435840 9:86575512-86575534 CAGAAAGCAAAGAAGAAGCAAGG + Intergenic
1056665296 9:88576785-88576807 CAGAGAACCCAGAGGAAAGCAGG - Intronic
1056798927 9:89677981-89678003 CAGAGAACAATGAAGAAGAAAGG - Intergenic
1057147907 9:92770769-92770791 CAGGGAACAGTGAGGAAGGAGGG - Intergenic
1057307891 9:93922760-93922782 CAGAGAAGAAGGAAGAGGGAGGG + Intergenic
1057895085 9:98902944-98902966 CATAGAAGATAGAAGAAAGAAGG - Intergenic
1058111228 9:101032462-101032484 AGGAGCACACAGAAGAAGGAAGG - Intronic
1058388032 9:104461500-104461522 CAGGTAAGAGAGAAGAAGGAAGG + Intergenic
1058643367 9:107108284-107108306 AAGAGATCACAGAAGAATAAAGG + Intergenic
1058670663 9:107358182-107358204 CACAGAAAACACAGGAAGGAAGG - Intergenic
1058814737 9:108672649-108672671 CAGAGAACACTGGAGGTGGAGGG - Intergenic
1059373330 9:113861649-113861671 CAGAGAACTCAGCAGGAGGATGG - Intergenic
1060187961 9:121575352-121575374 CCAGGACCACAGAAGAAGGAAGG - Intronic
1060192682 9:121603091-121603113 CAGAGGCCACAGTAGGAGGATGG - Intronic
1060313990 9:122491398-122491420 CTGAGGAAAAAGAAGAAGGAGGG + Intergenic
1061781082 9:132996395-132996417 CCGAGAACACAGAAGAATCTGGG + Intergenic
1061949212 9:133926842-133926864 CAGAGCACACAGAAGCAGAGAGG + Intronic
1061950081 9:133931284-133931306 CAGAGAGCCCAGCAGCAGGAGGG + Intronic
1185814482 X:3142347-3142369 AAGAGAAGAAAGAAGAAGAAAGG + Intergenic
1186136384 X:6526261-6526283 CAAAAAACAAAGAAGAAGGAAGG + Intergenic
1186185001 X:7012120-7012142 CAGAGAAGACATTAGAAGTAGGG - Intergenic
1186593127 X:10952721-10952743 CAGAGAACGAAGAAAAAGCAGGG + Intergenic
1187439165 X:19302416-19302438 CAGGGAAAACAGAAGACAGATGG - Intergenic
1187788221 X:22917728-22917750 GACAGTACACAGAAAAAGGAGGG + Intergenic
1188004937 X:25010776-25010798 AAGAGAAGAAGGAAGAAGGAGGG - Intronic
1188125426 X:26362055-26362077 CAGTGAACACAATAGACGGATGG + Intergenic
1188425361 X:30040778-30040800 AAGAGAGAAAAGAAGAAGGAAGG - Intergenic
1188454155 X:30343102-30343124 CAAAGAACACAGAATGAGAATGG - Intergenic
1188582584 X:31732997-31733019 AACAAAACACAGGAGAAGGAAGG + Intronic
1188752616 X:33922836-33922858 CATAGAACAGAGATGAAGGGTGG - Intergenic
1189642809 X:43091892-43091914 CAAAGAACCCAAAAGAAGGTAGG - Intergenic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1190101606 X:47526422-47526444 AAATGAAGACAGAAGAAGGAAGG - Intergenic
1190489223 X:50964499-50964521 GAGAGAACAAAAAAGAAAGAGGG + Intergenic
1190639298 X:52467220-52467242 CAGTGAACACATAAGATGGGAGG - Intergenic
1190914704 X:54802743-54802765 CAGAGAACAGGGGAGAATGAGGG + Intergenic
1190994980 X:55598064-55598086 CAGAGAAAAAATAAGAAGAATGG - Intergenic
1192270644 X:69576071-69576093 CAGAGGGCTCAGAAGAAGAAAGG - Intergenic
1192756392 X:74050278-74050300 CAGAGCACTTAGAAGAAGCATGG + Intergenic
1192871921 X:75192783-75192805 AACAGAAAACAGAAGAAAGAAGG - Intergenic
1193202467 X:78708254-78708276 CAGAGAATACAGAAGACGTAAGG - Intergenic
1193247555 X:79246809-79246831 CAAAGAACAGAAAGGAAGGAAGG + Intergenic
1193367018 X:80646816-80646838 TAGAGAACACAGGAGAAAGAAGG - Intergenic
1193958883 X:87899159-87899181 CAGAGAAAGCAGAGGAAGAAGGG + Intergenic
1194205500 X:91006322-91006344 AAGAGAACATAGGGGAAGGAAGG + Intergenic
1194271940 X:91826373-91826395 TAAAGAACACACAAGAAGTAGGG + Intronic
1194738031 X:97537637-97537659 GAGTGAGCACAGAAGATGGAAGG - Intronic
1195250720 X:103043549-103043571 CAGAGAAGACAGAAAAAGAGTGG - Intergenic
1195322020 X:103728153-103728175 CAGGGTCCAGAGAAGAAGGAAGG + Exonic
1195512394 X:105732187-105732209 CAGAGAAGGCAGAAAAAGCATGG - Intronic
1195666951 X:107440439-107440461 CTGAGCAAACAGAAGAGGGAGGG + Intergenic
1196000248 X:110775800-110775822 CAGAGAAGACAGAAAAAGAAAGG - Intronic
1196193304 X:112815801-112815823 CAGAGGTCAGAGAAGAAGTAGGG + Exonic
1196201934 X:112896490-112896512 CACAGAACAATGAAGAAGGAAGG + Intergenic
1196222961 X:113133800-113133822 CAGAGAACACCAAAGACAGAAGG - Intergenic
1196391228 X:115209694-115209716 CAGAGGGCTCAGAAGAAGGCAGG + Intronic
1196455987 X:115892021-115892043 CAGGGAACACAAACCAAGGAAGG + Intergenic
1196465623 X:115969091-115969113 CAGGAGACACAGAAGATGGAGGG - Intergenic
1197470145 X:126857054-126857076 CAGAGGACACAAAAGAAAAAAGG + Intergenic
1197718935 X:129731565-129731587 CAGAGTAAAGAGAGGAAGGAAGG + Intergenic
1198588706 X:138151256-138151278 CACAGAACAAAGAAGAAAAACGG - Intergenic
1200584370 Y:4989633-4989655 CATAGAACTCAAAAGAATGATGG + Intergenic
1200589189 Y:5047811-5047833 TAAAGAACACACAAGAAGTAGGG + Intronic
1201254391 Y:12092614-12092636 AAGAGAAAAGAAAAGAAGGAAGG + Intergenic
1201387729 Y:13461135-13461157 CAAAGAACAAAAAAGAAGGAAGG + Intronic
1201646191 Y:16235105-16235127 CACAGAACAGAGAAGAATGTGGG + Intergenic
1201656622 Y:16350212-16350234 CACAGAACAGAGAAGAATGTGGG - Intergenic
1201716783 Y:17053330-17053352 CAGAGAACCCAAAAGAAAGCAGG - Intergenic
1202273667 Y:23094715-23094737 AAGAGAAGAGAGAAGGAGGAAGG + Intergenic
1202292360 Y:23325966-23325988 AAGAGAAGAGAGAAGGAGGAAGG - Intergenic
1202426663 Y:24728460-24728482 AAGAGAAGAGAGAAGGAGGAAGG + Intergenic
1202444126 Y:24941626-24941648 AAGAGAAGAGAGAAGGAGGAAGG - Intergenic