ID: 909662264 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:78097290-78097312 |
| Sequence | TCTCCTGGTAGAAATCCAAG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 200 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 16, 4: 183} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 909662264_909662268 | -4 | Left | 909662264 | 1:78097290-78097312 | CCTCTTGGATTTCTACCAGGAGA | 0: 1 1: 0 2: 0 3: 16 4: 183 |
||
| Right | 909662268 | 1:78097309-78097331 | GAGAAGGGCCAGTCTTAGTGAGG | No data | ||||
| 909662264_909662270 | 22 | Left | 909662264 | 1:78097290-78097312 | CCTCTTGGATTTCTACCAGGAGA | 0: 1 1: 0 2: 0 3: 16 4: 183 |
||
| Right | 909662270 | 1:78097335-78097357 | AGTTTTCTCTGCATTCAGATAGG | 0: 1 1: 0 2: 0 3: 32 4: 333 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 909662264 | Original CRISPR | TCTCCTGGTAGAAATCCAAG AGG (reversed) | Intronic | ||