ID: 909662267

View in Genome Browser
Species Human (GRCh38)
Location 1:78097305-78097327
Sequence ACTAAGACTGGCCCTTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909662267_909662271 16 Left 909662267 1:78097305-78097327 CCAGGAGAAGGGCCAGTCTTAGT 0: 1
1: 0
2: 1
3: 9
4: 104
Right 909662271 1:78097344-78097366 TGCATTCAGATAGGCCACCTTGG No data
909662267_909662270 7 Left 909662267 1:78097305-78097327 CCAGGAGAAGGGCCAGTCTTAGT 0: 1
1: 0
2: 1
3: 9
4: 104
Right 909662270 1:78097335-78097357 AGTTTTCTCTGCATTCAGATAGG 0: 1
1: 0
2: 0
3: 32
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909662267 Original CRISPR ACTAAGACTGGCCCTTCTCC TGG (reversed) Intronic