ID: 909662269

View in Genome Browser
Species Human (GRCh38)
Location 1:78097317-78097339
Sequence AAACTCTGCCTCACTAAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 179}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909662269_909662271 4 Left 909662269 1:78097317-78097339 CCAGTCTTAGTGAGGCAGAGTTT 0: 1
1: 0
2: 3
3: 23
4: 179
Right 909662271 1:78097344-78097366 TGCATTCAGATAGGCCACCTTGG No data
909662269_909662274 26 Left 909662269 1:78097317-78097339 CCAGTCTTAGTGAGGCAGAGTTT 0: 1
1: 0
2: 3
3: 23
4: 179
Right 909662274 1:78097366-78097388 GCTGTAGCTAAGTCACTTATAGG 0: 1
1: 0
2: 1
3: 5
4: 69
909662269_909662270 -5 Left 909662269 1:78097317-78097339 CCAGTCTTAGTGAGGCAGAGTTT 0: 1
1: 0
2: 3
3: 23
4: 179
Right 909662270 1:78097335-78097357 AGTTTTCTCTGCATTCAGATAGG 0: 1
1: 0
2: 0
3: 32
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909662269 Original CRISPR AAACTCTGCCTCACTAAGAC TGG (reversed) Intronic