ID: 909662269

View in Genome Browser
Species Human (GRCh38)
Location 1:78097317-78097339
Sequence AAACTCTGCCTCACTAAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 179}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909662269_909662271 4 Left 909662269 1:78097317-78097339 CCAGTCTTAGTGAGGCAGAGTTT 0: 1
1: 0
2: 3
3: 23
4: 179
Right 909662271 1:78097344-78097366 TGCATTCAGATAGGCCACCTTGG No data
909662269_909662274 26 Left 909662269 1:78097317-78097339 CCAGTCTTAGTGAGGCAGAGTTT 0: 1
1: 0
2: 3
3: 23
4: 179
Right 909662274 1:78097366-78097388 GCTGTAGCTAAGTCACTTATAGG 0: 1
1: 0
2: 1
3: 5
4: 69
909662269_909662270 -5 Left 909662269 1:78097317-78097339 CCAGTCTTAGTGAGGCAGAGTTT 0: 1
1: 0
2: 3
3: 23
4: 179
Right 909662270 1:78097335-78097357 AGTTTTCTCTGCATTCAGATAGG 0: 1
1: 0
2: 0
3: 32
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909662269 Original CRISPR AAACTCTGCCTCACTAAGAC TGG (reversed) Intronic
904156341 1:28486344-28486366 AAACTCTGTCTCAAAAAGAAAGG + Intronic
907858587 1:58327999-58328021 CACCTCTGCCTCACTCAGCCAGG - Intronic
909122292 1:71618456-71618478 AAACCCTGCTTCACAAAGACAGG - Intronic
909464160 1:75954037-75954059 AAACTTTGCTTCACTAATGCTGG - Intergenic
909586635 1:77297452-77297474 AAATTCTGTGTCACCAAGACAGG - Intronic
909662269 1:78097317-78097339 AAACTCTGCCTCACTAAGACTGG - Intronic
910950657 1:92644182-92644204 AAACTCAGCATCACTAATAATGG + Intronic
911792356 1:102033614-102033636 AAACCCTGCTTCACAAAGATAGG - Intergenic
919091322 1:192981557-192981579 AAACCCTGCTTCACAAAGATAGG - Intergenic
922223927 1:223628884-223628906 AAACTCTACCTGACTCAGAAGGG - Intronic
922671797 1:227514180-227514202 AAACCCTGCTTCACAAAGACAGG + Intergenic
923645077 1:235811706-235811728 AATCTGTGCTTTACTAAGACAGG + Intronic
924244505 1:242070668-242070690 AAACCCTGTTTCACAAAGACAGG + Intergenic
924799292 1:247315856-247315878 AAACTCTGACTCAGTAGGTCGGG + Intronic
924821773 1:247498992-247499014 AAACCATGCTTCACAAAGACAGG + Intergenic
1063005885 10:1970249-1970271 AAATCCTGCTTCACAAAGACAGG - Intergenic
1063065098 10:2600032-2600054 AAACTCAGCCTCCCTCAGCCGGG - Intergenic
1067410166 10:46056948-46056970 AAACTCCACCTCAAAAAGACAGG + Intergenic
1069149228 10:64934592-64934614 AAAGTCTGCTTCCCTAATACTGG - Intergenic
1070143333 10:73755371-73755393 AAACTCTGACTCACTCCAACTGG - Intronic
1071501158 10:86205158-86205180 ATACTCTTCTTCTCTAAGACTGG - Intronic
1074628204 10:115218278-115218300 AAACTCTGCTCCACGAAGACAGG + Intronic
1078076104 11:8162277-8162299 AAAGTCAGCTTGACTAAGACAGG - Intronic
1079000617 11:16752005-16752027 AAACCCTGTTTCACAAAGACAGG - Intronic
1079570121 11:21932646-21932668 AAACCCTGCTTCACAAAGATAGG - Intergenic
1079991094 11:27248066-27248088 AAACTTTGCATCACTAATACTGG + Intergenic
1080634427 11:34111204-34111226 ATGCTCTGCCAGACTAAGACAGG - Intronic
1081753004 11:45525422-45525444 AAAATATTCCTCACTGAGACAGG + Intergenic
1084553433 11:69862583-69862605 AATCTCGGCCCCACAAAGACGGG + Intergenic
1086886989 11:92217563-92217585 AATGTCTGCATCACTAAGTCTGG + Intergenic
1089668168 11:120033351-120033373 AGACTCTGCCAGACTAAAACTGG - Intergenic
1090439193 11:126712350-126712372 AGACCCTGCCTCACTCAGAGAGG - Intronic
1090766124 11:129877801-129877823 AAGTTCTGCCACACTTAGACCGG + Intronic
1091710485 12:2736769-2736791 AATCTCTGCATCTCCAAGACTGG - Intergenic
1093136273 12:15455334-15455356 AATCTCTGCCTACCTAAGGCAGG + Intronic
1093710761 12:22327565-22327587 ACACCCTGCCTCACTGAGAAAGG + Intronic
1094163966 12:27422884-27422906 AAACTCTGCCTCTCAAATCCTGG - Intronic
1094812782 12:34156141-34156163 AAAGCCTGCTTCACAAAGACAGG - Intergenic
1096771283 12:53937618-53937640 AAACTATTCCTCACTAAAAGAGG + Intergenic
1097446020 12:59672402-59672424 AAAGTCTGTCTCACTGATACAGG - Intronic
1108200641 13:48039527-48039549 CAACTCTGCCCCCCCAAGACAGG - Intronic
1109205256 13:59476155-59476177 AGAATCTGCCTCTCTAAGAAGGG + Intergenic
1111158190 13:84356234-84356256 AAACTCTACCTCACTGAGATAGG + Intergenic
1113474422 13:110570160-110570182 TAACTCTGCCTCACCCAGGCTGG - Intergenic
1118516696 14:66537729-66537751 AAAATCTGCCTCAAAGAGACTGG - Intronic
1118526620 14:66651729-66651751 AAACCCTGCTTCACAAAGACAGG - Intronic
1118762760 14:68890573-68890595 AGACTCTCCCTGACTAGGACTGG + Intronic
1118825058 14:69372317-69372339 AAACACTGACTCACTGATACGGG + Intergenic
1120149826 14:81020889-81020911 AAACCCTGCTTCACAAAGATAGG - Intronic
1121733457 14:96202307-96202329 AAACCCTGCCCCACTAAGCAGGG - Intergenic
1124440275 15:29680753-29680775 AAACTCTGCTTCACAAACACAGG + Intergenic
1124956805 15:34365585-34365607 AAGCTGCTCCTCACTAAGACCGG + Exonic
1126457249 15:48877140-48877162 AAATCCTGCCTCACAAAGATAGG - Intronic
1127107067 15:55627881-55627903 CGACTCTGACTCACTAAGTCTGG + Intronic
1128479332 15:68023729-68023751 TAACACTGCCTCCCTAAAACGGG - Intergenic
1129584476 15:76848927-76848949 AAACTCTGTGTCACTAACAGTGG - Intronic
1129584717 15:76850396-76850418 AAACTCTGTGTCACTAACAGTGG - Intronic
1131631752 15:94184559-94184581 AAACCCTGCTTCACAAAGACAGG + Intergenic
1131788534 15:95938799-95938821 AAACTCTGTCTCAAAAAGAAAGG + Intergenic
1134882578 16:17758649-17758671 AGACTCTGACTCAATAGGACTGG + Intergenic
1136009956 16:27357017-27357039 AAGCTCAACCTCACTAAGTCAGG + Intronic
1140698884 16:77562908-77562930 AATCTCTTCCTCTCTAAAACAGG - Intergenic
1143998037 17:11025328-11025350 AAACTCTCCCACACTAAGCTTGG + Intergenic
1144383536 17:14727111-14727133 AAAATCTGCCTCTGTAAGCCAGG + Intergenic
1145935844 17:28714388-28714410 ACACTCTCCCTCACTACCACTGG + Exonic
1146470861 17:33123643-33123665 AAACTCTGCATTACTCTGACTGG + Intronic
1150321611 17:64218854-64218876 AAACCAGGCCTCACTTAGACTGG + Intronic
1152163770 17:78687304-78687326 AAACACTGCTTCACAAAGACAGG + Intronic
1155112243 18:22727506-22727528 AAATTCTGCTTCACTAAGATAGG - Intergenic
1159792535 18:72800381-72800403 AAACCCTGCTTCACAAAGATAGG - Intronic
1161040477 19:2108497-2108519 AGACTCTCCCTCAGCAAGACAGG - Intronic
1163405955 19:17122505-17122527 AGACTCTGCCTCAAAAAAACAGG + Intronic
1165308468 19:35016582-35016604 AAACTCTGTCTCAAAAAAACAGG + Intronic
1167894586 19:52570704-52570726 GAACTCGGCCTCCCTGAGACTGG - Exonic
1168030568 19:53676431-53676453 AAGCTCTGTCTCAAAAAGACTGG - Intergenic
1168351421 19:55678322-55678344 ATACTCTGCCTCACTGAGCAGGG + Intronic
1168717934 19:58539955-58539977 AGACTCTGCTTCCCTGAGACAGG + Intergenic
926140004 2:10362841-10362863 AAACTCACCCTCTCTAACACAGG - Intronic
926528064 2:14007763-14007785 TACCTCTGCCTCTCTGAGACAGG + Intergenic
926824699 2:16892887-16892909 AAACTCTGCTTCACAAACATAGG - Intergenic
928040359 2:27869835-27869857 AAACTCTGCTTCACAAAGATAGG + Intronic
928573612 2:32632255-32632277 CACCTCTGCCTCACTAAGTGTGG + Intronic
929174662 2:38964156-38964178 AAACCCTGCTTCACAAAGATGGG + Intronic
929226751 2:39519015-39519037 AAACTCAGCTTCCCAAAGACAGG - Intergenic
929367652 2:41179918-41179940 AGATTCTGCTTCACTAAGTCTGG + Intergenic
929785863 2:44990682-44990704 AGACTCTGTCTCAATAAAACAGG + Intergenic
930167603 2:48218825-48218847 AAATTCTGCCTCAGTAGGTCTGG - Intergenic
930317449 2:49815043-49815065 AGACTCTGATTCACTAAGTCTGG - Intergenic
933144884 2:78839983-78840005 AAAATCTGCCTCACCAGTACTGG - Intergenic
933480484 2:82851186-82851208 AAACCCTGCTTCACAAAGACAGG + Intergenic
936494372 2:113005387-113005409 AAGTTCTGCCTCACTAAGTCTGG - Intergenic
936689924 2:114874410-114874432 AAACCCTGCTTCACCAAGATAGG - Intronic
936779250 2:116012432-116012454 ATCCTCTGCCTCACTGAGGCTGG - Intergenic
940950368 2:159666339-159666361 AATCTCTGCCTCACTGACTCAGG + Intergenic
941726091 2:168862114-168862136 TAAGGCTGCCACACTAAGACAGG - Intronic
942527120 2:176865577-176865599 GAAGGCTTCCTCACTAAGACTGG - Intergenic
943301362 2:186206744-186206766 ATACTCTGCCTCACAATGAAGGG - Intergenic
943705534 2:191029811-191029833 AAACTCTGACGCACCAAGAAAGG - Exonic
943818692 2:192290459-192290481 AAACCCTGCTTCACAAAGATAGG + Intergenic
946677252 2:222173884-222173906 AGACTCTGCCTTACAAAGAAGGG - Intergenic
947112873 2:226738450-226738472 TAACTCTGCCTCTAAAAGACAGG + Intronic
1170170008 20:13399854-13399876 CTACTCTGACCCACTAAGACCGG + Intronic
1172354056 20:34266913-34266935 AAACTGAGGCACACTAAGACAGG - Intronic
1173262518 20:41449380-41449402 AATGTCTGTCTCCCTAAGACAGG + Intronic
1177077893 21:16600395-16600417 AAATTCTGACTCACTAGGTCTGG + Intergenic
1177601985 21:23327514-23327536 AAATTCTGCCTAACTCAGTCTGG - Intergenic
1178929367 21:36804276-36804298 ACACTCTGCCTCACTGACAAGGG + Intronic
1179188098 21:39100355-39100377 AAACCCTGCTTCACAAAGATAGG - Intergenic
1179298189 21:40081848-40081870 AAACTCTCCCTCACTAAAACTGG + Intronic
1179639424 21:42737539-42737561 AACCTCTGCCCCCCGAAGACAGG + Intronic
1180760538 22:18199292-18199314 AAACTCTGGGTAACCAAGACTGG + Intergenic
1180775131 22:18425404-18425426 AAACTCTGGGTAACCAAGACTGG - Intergenic
1180808206 22:18736459-18736481 AAACTCTGGGTAACCAAGACTGG - Intergenic
1181071130 22:20341424-20341446 AAACTCTGGGTAACCAAGACTGG - Intergenic
1181194201 22:21170373-21170395 AAACTCTGGGTAACCAAGACTGG - Intergenic
1181215240 22:21322405-21322427 AAACTCTGGGTAACCAAGACTGG + Intergenic
1181967076 22:26664357-26664379 AAACTATGCCTCAATAAAATTGG - Intergenic
1182846600 22:33436397-33436419 GAACTCTGCCTCTCTAAGTGTGG + Intronic
1182894556 22:33848545-33848567 AAACTCTGCCTTACTCAGGAAGG + Intronic
1184513906 22:44948720-44948742 AAACCCGGCTTCACAAAGACAGG + Intronic
949166546 3:949671-949693 AAACTCTGTAACACTAAGTCAGG - Intergenic
949739319 3:7212139-7212161 AAACTATGCCTCATTTAGAAGGG - Intronic
955714020 3:61809908-61809930 AAGCTCTGCCTCCCTGATACAGG - Intronic
957216395 3:77325415-77325437 CAACTCTGCCACACTTTGACTGG + Intronic
957343987 3:78938902-78938924 AAAATCTTCCTGACGAAGACGGG + Exonic
958568947 3:95855051-95855073 TAAATATGCCTCACTCAGACAGG - Intergenic
962556689 3:136559763-136559785 AAACTCAGCCTCTCAAAGATAGG - Intronic
963356308 3:144212581-144212603 AAACCCTGCTTCACAAAGATAGG + Intergenic
963842019 3:150117401-150117423 AAACTCTGCTGCTCTAAGACAGG + Intergenic
965135082 3:164754544-164754566 CATCTCTGCTTCACTAAGCCTGG + Intergenic
966062541 3:175776620-175776642 AAAGTCTGCATCTCGAAGACTGG + Intronic
966803107 3:183783158-183783180 AATCTCTTCATCTCTAAGACAGG + Intronic
968239911 3:197069948-197069970 AAACTCTGCTTTGATAAGACTGG + Intronic
972336437 4:38110905-38110927 AAGCTCTGCCTCAAGAAGACAGG - Intronic
974270783 4:59649338-59649360 AAAGTCTATCTCCCTAAGACTGG + Intergenic
975625355 4:76340567-76340589 AAACACTGCTTCACAAAGATAGG - Intronic
976122718 4:81800583-81800605 AAACCCTGCTTCACAAAGATAGG + Intronic
976180400 4:82393539-82393561 AAACCCTGCTTCACAAAGATAGG - Intergenic
977310077 4:95374745-95374767 AGACCATGCCTCACTTAGACTGG - Intronic
977468051 4:97406574-97406596 AAAGTCTTACTCAGTAAGACAGG + Intronic
978222463 4:106293262-106293284 AAACCCTGCTTCACAAAGATAGG - Intronic
979204548 4:118022166-118022188 AAACTGTACCTCACTGAAACTGG + Intergenic
982039799 4:151385513-151385535 AAACCCTGCTTCACAAAGATAGG + Intergenic
983677640 4:170314707-170314729 AAACTCAGCTTCACAAAGATAGG - Intergenic
985753417 5:1697339-1697361 AAACTCTGCTTCACAAAGACAGG + Intergenic
987286155 5:16459436-16459458 AAACTCTCCCTCACTACAAGTGG + Intronic
987993180 5:25241930-25241952 AAACCCTGCTTCACAAAGATAGG + Intergenic
988136110 5:27173872-27173894 AAACCCTGCTTCACAAAGATTGG - Intergenic
989409070 5:41096542-41096564 ATACACTGCCCCACTAAGAAAGG - Intergenic
989480270 5:41923222-41923244 AAACTCTGGCTCATTTTGACGGG - Intergenic
990597877 5:57329536-57329558 AGATTCTGCATCACTAAGAATGG + Intergenic
993225544 5:85164757-85164779 AAACTCTGCATCACTACCAGTGG + Intergenic
993546098 5:89215447-89215469 AAATTCTGCTTCAGTAAGTCTGG + Intergenic
993672628 5:90779663-90779685 CAAATCTGCCTCACTAAATCAGG - Intronic
995463903 5:112431097-112431119 AAACCCTGCTTCACAAAGATAGG + Intergenic
995630051 5:114123125-114123147 AAACACTGCCTCAGTAAGAGTGG - Intergenic
995861355 5:116644222-116644244 AAACCCTGCTTCACAAAGATAGG + Intergenic
996792079 5:127304152-127304174 AAACTCTGCCTTCCTAATTCAGG + Intronic
997086121 5:130801774-130801796 AAATTATGCCTCAATAAGGCTGG + Intergenic
999319332 5:150603701-150603723 CATCTCTGCCTCACCAAGAAGGG - Intronic
1000022562 5:157331195-157331217 ACAGTCTTCCTCACTTAGACCGG - Intronic
1000276863 5:159745564-159745586 AAACTCTGACCCACTAATAGTGG + Intergenic
1001882113 5:175253384-175253406 AAACTCTGACTCAGTAGGTCTGG + Intergenic
1002336219 5:178480273-178480295 AAACTCTGCCTCCCTCAGACAGG + Intronic
1004758580 6:18640904-18640926 AAATTCTGCCTCACAAAGCATGG + Intergenic
1009878299 6:69533607-69533629 AAACTGGGCCTAATTAAGACAGG - Intergenic
1011656223 6:89554365-89554387 AAACTCTGCCTCTCTTATAAAGG + Intronic
1012600079 6:101085480-101085502 CAACTTTGCCTCACTGAGAAAGG - Intergenic
1012631803 6:101479341-101479363 AAATTCTCCCTCACTGAGAAGGG - Intronic
1013036079 6:106384590-106384612 AAACCCTGCTTCACAAAGATAGG + Intergenic
1016894403 6:149038053-149038075 AAACTCTGTCTTCCTAAAACTGG + Intronic
1017097329 6:150816199-150816221 AAACCCTGCTTCACAAAGATAGG + Intronic
1018596551 6:165487254-165487276 AAACCCTGCTTCACAAAGACAGG - Intronic
1018664527 6:166122927-166122949 AAACCCTGCTTCACAAAGACAGG + Intergenic
1019906699 7:4070345-4070367 AAACTCTGCTTTGCAAAGACAGG + Intronic
1025723718 7:64038538-64038560 AAACTCAGCCTCACAGAGAAGGG + Intronic
1031835955 7:126682538-126682560 ACACTCTTATTCACTAAGACAGG + Intronic
1033852386 7:145513310-145513332 AAACTGTACCTCAGAAAGACTGG - Intergenic
1034829723 7:154298780-154298802 AAACTCTTCCTCTCGAAGCCTGG + Intronic
1036382638 8:8247412-8247434 AAATCCTGCTTCACAAAGACAGG - Intergenic
1038973803 8:32669004-32669026 AAACTCTGCCTCACAAACTGTGG - Intronic
1042172330 8:66004260-66004282 AAGCCCTGCTTCACAAAGACAGG - Intergenic
1042573233 8:70190364-70190386 AAACTATGAGTCACTAAGTCAGG + Intronic
1042710393 8:71710732-71710754 AAACACTTTCTCACTAAGTCAGG - Intergenic
1043979713 8:86623918-86623940 AAACTCTGCTTCAATAACCCTGG + Intronic
1044031757 8:87247045-87247067 AAACTCTGCTTCACAAAGGTAGG + Intronic
1044409568 8:91868306-91868328 AAACCCTGACTCAGTCAGACTGG + Intergenic
1047748259 8:127861215-127861237 AAACTCTGTCTCAATAAAAAAGG - Intergenic
1050057080 9:1667005-1667027 AAACCCTGCTTCACAAAGATAGG - Intergenic
1055703822 9:78976033-78976055 AAACTCCCCCTCACAAAGAAAGG + Intergenic
1056710487 9:88989061-88989083 AAACTCAGTGTCACTAATACTGG - Intergenic
1057775835 9:98008617-98008639 AAACTTTGCTTCACAAAGATAGG - Intronic
1058229481 9:102408214-102408236 AAACTCTGCTTCACAAAGATCGG - Intergenic
1059073177 9:111161184-111161206 AAACTCTGCCTCGGTAAGCTGGG - Intergenic
1059989071 9:119847557-119847579 AAAGTCTGTCTCAACAAGACTGG + Intergenic
1061776231 9:132966745-132966767 AAACTCAGCATCACTAAGGTGGG + Intronic
1061932451 9:133840232-133840254 AAACTCTGCTTCCCGAAGCCGGG - Intronic
1190141219 X:47846858-47846880 TAACTCCACCTCCCTAAGACAGG + Intronic
1190215840 X:48478910-48478932 AGGCTTTGCCTCTCTAAGACTGG - Intronic
1192753168 X:74016278-74016300 AAACTCTCCCTCTTTAAGAATGG - Intergenic
1195805736 X:108763356-108763378 AACCTCTGCCCCAGTAAGTCTGG - Intergenic
1196491091 X:116267817-116267839 AAGCTCTGACTCACTTAAACTGG + Intergenic
1201757877 Y:17507215-17507237 AAACTCTGCTTCAGAAAGACAGG - Intergenic
1201843677 Y:18398767-18398789 AAACTCTGCTTCAGAAAGACAGG + Intergenic
1202339548 Y:23847990-23848012 AAACTCTGACTCACTCAGATGGG + Intergenic
1202531218 Y:25822078-25822100 AAACTCTGACTCACTCAGATGGG - Intergenic