ID: 909662270

View in Genome Browser
Species Human (GRCh38)
Location 1:78097335-78097357
Sequence AGTTTTCTCTGCATTCAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 333}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909662267_909662270 7 Left 909662267 1:78097305-78097327 CCAGGAGAAGGGCCAGTCTTAGT 0: 1
1: 0
2: 1
3: 9
4: 104
Right 909662270 1:78097335-78097357 AGTTTTCTCTGCATTCAGATAGG 0: 1
1: 0
2: 0
3: 32
4: 333
909662264_909662270 22 Left 909662264 1:78097290-78097312 CCTCTTGGATTTCTACCAGGAGA 0: 1
1: 0
2: 0
3: 16
4: 183
Right 909662270 1:78097335-78097357 AGTTTTCTCTGCATTCAGATAGG 0: 1
1: 0
2: 0
3: 32
4: 333
909662269_909662270 -5 Left 909662269 1:78097317-78097339 CCAGTCTTAGTGAGGCAGAGTTT 0: 1
1: 0
2: 3
3: 23
4: 179
Right 909662270 1:78097335-78097357 AGTTTTCTCTGCATTCAGATAGG 0: 1
1: 0
2: 0
3: 32
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909662270 Original CRISPR AGTTTTCTCTGCATTCAGAT AGG Intronic