ID: 909662271 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:78097344-78097366 |
| Sequence | TGCATTCAGATAGGCCACCT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 909662267_909662271 | 16 | Left | 909662267 | 1:78097305-78097327 | CCAGGAGAAGGGCCAGTCTTAGT | 0: 1 1: 0 2: 1 3: 9 4: 104 |
||
| Right | 909662271 | 1:78097344-78097366 | TGCATTCAGATAGGCCACCTTGG | No data | ||||
| 909662269_909662271 | 4 | Left | 909662269 | 1:78097317-78097339 | CCAGTCTTAGTGAGGCAGAGTTT | 0: 1 1: 0 2: 3 3: 23 4: 179 |
||
| Right | 909662271 | 1:78097344-78097366 | TGCATTCAGATAGGCCACCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 909662271 | Original CRISPR | TGCATTCAGATAGGCCACCT TGG | Intronic | ||