ID: 909662271

View in Genome Browser
Species Human (GRCh38)
Location 1:78097344-78097366
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909662269_909662271 4 Left 909662269 1:78097317-78097339 CCAGTCTTAGTGAGGCAGAGTTT 0: 1
1: 0
2: 3
3: 23
4: 179
Right 909662271 1:78097344-78097366 TGCATTCAGATAGGCCACCTTGG No data
909662267_909662271 16 Left 909662267 1:78097305-78097327 CCAGGAGAAGGGCCAGTCTTAGT 0: 1
1: 0
2: 1
3: 9
4: 104
Right 909662271 1:78097344-78097366 TGCATTCAGATAGGCCACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type