ID: 909666906

View in Genome Browser
Species Human (GRCh38)
Location 1:78144314-78144336
Sequence CACCTTAACCAGAAGAAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909666906_909666909 12 Left 909666906 1:78144314-78144336 CCAAGCTTCTTCTGGTTAAGGTG No data
Right 909666909 1:78144349-78144371 AATTGATTTGACTTGGACAGTGG No data
909666906_909666911 28 Left 909666906 1:78144314-78144336 CCAAGCTTCTTCTGGTTAAGGTG No data
Right 909666911 1:78144365-78144387 ACAGTGGGTATTTTGCTTTCTGG No data
909666906_909666908 5 Left 909666906 1:78144314-78144336 CCAAGCTTCTTCTGGTTAAGGTG No data
Right 909666908 1:78144342-78144364 ATGGTTTAATTGATTTGACTTGG No data
909666906_909666910 13 Left 909666906 1:78144314-78144336 CCAAGCTTCTTCTGGTTAAGGTG No data
Right 909666910 1:78144350-78144372 ATTGATTTGACTTGGACAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909666906 Original CRISPR CACCTTAACCAGAAGAAGCT TGG (reversed) Intergenic
No off target data available for this crispr