ID: 909667872

View in Genome Browser
Species Human (GRCh38)
Location 1:78155631-78155653
Sequence CAGTATATGCATCTTTTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909667872_909667873 14 Left 909667872 1:78155631-78155653 CCATGAAAAAGATGCATATACTG No data
Right 909667873 1:78155668-78155690 TATTGAACTTTTACTTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909667872 Original CRISPR CAGTATATGCATCTTTTTCA TGG (reversed) Intergenic
No off target data available for this crispr