ID: 909674255

View in Genome Browser
Species Human (GRCh38)
Location 1:78221539-78221561
Sequence AGATGTACACCACTGTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909674255_909674257 23 Left 909674255 1:78221539-78221561 CCTTCCAACAGTGGTGTACATCT No data
Right 909674257 1:78221585-78221607 TCTTATTAAAAAATTGAGTGTGG No data
909674255_909674258 29 Left 909674255 1:78221539-78221561 CCTTCCAACAGTGGTGTACATCT No data
Right 909674258 1:78221591-78221613 TAAAAAATTGAGTGTGGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909674255 Original CRISPR AGATGTACACCACTGTTGGA AGG (reversed) Intergenic
No off target data available for this crispr