ID: 909674257

View in Genome Browser
Species Human (GRCh38)
Location 1:78221585-78221607
Sequence TCTTATTAAAAAATTGAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909674253_909674257 28 Left 909674253 1:78221534-78221556 CCCAGCCTTCCAACAGTGGTGTA No data
Right 909674257 1:78221585-78221607 TCTTATTAAAAAATTGAGTGTGG No data
909674255_909674257 23 Left 909674255 1:78221539-78221561 CCTTCCAACAGTGGTGTACATCT No data
Right 909674257 1:78221585-78221607 TCTTATTAAAAAATTGAGTGTGG No data
909674254_909674257 27 Left 909674254 1:78221535-78221557 CCAGCCTTCCAACAGTGGTGTAC No data
Right 909674257 1:78221585-78221607 TCTTATTAAAAAATTGAGTGTGG No data
909674256_909674257 19 Left 909674256 1:78221543-78221565 CCAACAGTGGTGTACATCTTCAT No data
Right 909674257 1:78221585-78221607 TCTTATTAAAAAATTGAGTGTGG No data
909674252_909674257 29 Left 909674252 1:78221533-78221555 CCCCAGCCTTCCAACAGTGGTGT No data
Right 909674257 1:78221585-78221607 TCTTATTAAAAAATTGAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909674257 Original CRISPR TCTTATTAAAAAATTGAGTG TGG Intergenic
No off target data available for this crispr