ID: 909674258

View in Genome Browser
Species Human (GRCh38)
Location 1:78221591-78221613
Sequence TAAAAAATTGAGTGTGGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909674255_909674258 29 Left 909674255 1:78221539-78221561 CCTTCCAACAGTGGTGTACATCT No data
Right 909674258 1:78221591-78221613 TAAAAAATTGAGTGTGGTAGAGG No data
909674256_909674258 25 Left 909674256 1:78221543-78221565 CCAACAGTGGTGTACATCTTCAT No data
Right 909674258 1:78221591-78221613 TAAAAAATTGAGTGTGGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909674258 Original CRISPR TAAAAAATTGAGTGTGGTAG AGG Intergenic
No off target data available for this crispr