ID: 909675705

View in Genome Browser
Species Human (GRCh38)
Location 1:78237109-78237131
Sequence CCAACTAATGTCCATTAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909675705_909675710 12 Left 909675705 1:78237109-78237131 CCAACTTAATGGACATTAGTTGG No data
Right 909675710 1:78237144-78237166 CACAATGGCTTGCAACCCAATGG No data
909675705_909675712 16 Left 909675705 1:78237109-78237131 CCAACTTAATGGACATTAGTTGG No data
Right 909675712 1:78237148-78237170 ATGGCTTGCAACCCAATGGTGGG No data
909675705_909675711 15 Left 909675705 1:78237109-78237131 CCAACTTAATGGACATTAGTTGG No data
Right 909675711 1:78237147-78237169 AATGGCTTGCAACCCAATGGTGG No data
909675705_909675709 -3 Left 909675705 1:78237109-78237131 CCAACTTAATGGACATTAGTTGG No data
Right 909675709 1:78237129-78237151 TGGGCATCTGGTCTGCACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909675705 Original CRISPR CCAACTAATGTCCATTAAGT TGG (reversed) Intergenic