ID: 909675711

View in Genome Browser
Species Human (GRCh38)
Location 1:78237147-78237169
Sequence AATGGCTTGCAACCCAATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909675705_909675711 15 Left 909675705 1:78237109-78237131 CCAACTTAATGGACATTAGTTGG No data
Right 909675711 1:78237147-78237169 AATGGCTTGCAACCCAATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909675711 Original CRISPR AATGGCTTGCAACCCAATGG TGG Intergenic