ID: 909675712

View in Genome Browser
Species Human (GRCh38)
Location 1:78237148-78237170
Sequence ATGGCTTGCAACCCAATGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909675705_909675712 16 Left 909675705 1:78237109-78237131 CCAACTTAATGGACATTAGTTGG No data
Right 909675712 1:78237148-78237170 ATGGCTTGCAACCCAATGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909675712 Original CRISPR ATGGCTTGCAACCCAATGGT GGG Intergenic