ID: 909677282

View in Genome Browser
Species Human (GRCh38)
Location 1:78252545-78252567
Sequence CGGAGTGTAAGCAGCACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909677282_909677288 13 Left 909677282 1:78252545-78252567 CCATCTGTGCTGCTTACACTCCG No data
Right 909677288 1:78252581-78252603 GTGCATTCTCTGCCCTGCTGTGG No data
909677282_909677284 -9 Left 909677282 1:78252545-78252567 CCATCTGTGCTGCTTACACTCCG No data
Right 909677284 1:78252559-78252581 TACACTCCGTTGGACCCTTCAGG No data
909677282_909677293 23 Left 909677282 1:78252545-78252567 CCATCTGTGCTGCTTACACTCCG No data
Right 909677293 1:78252591-78252613 TGCCCTGCTGTGGGATTTGGGGG No data
909677282_909677290 20 Left 909677282 1:78252545-78252567 CCATCTGTGCTGCTTACACTCCG No data
Right 909677290 1:78252588-78252610 CTCTGCCCTGCTGTGGGATTTGG No data
909677282_909677291 21 Left 909677282 1:78252545-78252567 CCATCTGTGCTGCTTACACTCCG No data
Right 909677291 1:78252589-78252611 TCTGCCCTGCTGTGGGATTTGGG No data
909677282_909677296 28 Left 909677282 1:78252545-78252567 CCATCTGTGCTGCTTACACTCCG No data
Right 909677296 1:78252596-78252618 TGCTGTGGGATTTGGGGGCTTGG No data
909677282_909677292 22 Left 909677282 1:78252545-78252567 CCATCTGTGCTGCTTACACTCCG No data
Right 909677292 1:78252590-78252612 CTGCCCTGCTGTGGGATTTGGGG No data
909677282_909677289 14 Left 909677282 1:78252545-78252567 CCATCTGTGCTGCTTACACTCCG No data
Right 909677289 1:78252582-78252604 TGCATTCTCTGCCCTGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909677282 Original CRISPR CGGAGTGTAAGCAGCACAGA TGG (reversed) Intergenic
No off target data available for this crispr