ID: 909680660

View in Genome Browser
Species Human (GRCh38)
Location 1:78287810-78287832
Sequence CCTACTATGTGGAAGAAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909680654_909680660 -7 Left 909680654 1:78287794-78287816 CCCAAGGGAGAAAGAGCCTACTA No data
Right 909680660 1:78287810-78287832 CCTACTATGTGGAAGAAGTGGGG No data
909680651_909680660 19 Left 909680651 1:78287768-78287790 CCAGACAAGTTTGTTAATATGTT No data
Right 909680660 1:78287810-78287832 CCTACTATGTGGAAGAAGTGGGG No data
909680650_909680660 29 Left 909680650 1:78287758-78287780 CCTTTAATAACCAGACAAGTTTG No data
Right 909680660 1:78287810-78287832 CCTACTATGTGGAAGAAGTGGGG No data
909680655_909680660 -8 Left 909680655 1:78287795-78287817 CCAAGGGAGAAAGAGCCTACTAT No data
Right 909680660 1:78287810-78287832 CCTACTATGTGGAAGAAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909680660 Original CRISPR CCTACTATGTGGAAGAAGTG GGG Intergenic
No off target data available for this crispr