ID: 909685110

View in Genome Browser
Species Human (GRCh38)
Location 1:78339294-78339316
Sequence ATGGGGAGGTGGGATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1873
Summary {0: 1, 1: 0, 2: 14, 3: 187, 4: 1671}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909685110_909685119 7 Left 909685110 1:78339294-78339316 CCTTCCTCATCCCACCTCCCCAT 0: 1
1: 0
2: 14
3: 187
4: 1671
Right 909685119 1:78339324-78339346 TCTTCCTCCCTACCCTACTCAGG 0: 1
1: 1
2: 1
3: 36
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909685110 Original CRISPR ATGGGGAGGTGGGATGAGGA AGG (reversed) Intronic
900700782 1:4047487-4047509 AAGGGGAGGAAGGAGGAGGAAGG + Intergenic
900712406 1:4122660-4122682 CTGGGGAGGCGGGAGAAGGAGGG + Intergenic
900741175 1:4332226-4332248 CTGGGGAGCTGGGAAGGGGATGG + Intergenic
900760462 1:4467000-4467022 ATGGGGCAGTGGGAGGAGGTTGG - Intergenic
900782314 1:4626160-4626182 AGGAGGAGGTGGGAGGTGGAAGG + Intergenic
900821556 1:4893482-4893504 ATGGGGAGGTGGGGAGTGGGTGG - Intergenic
901049000 1:6416899-6416921 CTGGGGAGGTGTGGAGAGGAGGG - Exonic
901209483 1:7516378-7516400 ATTGGGGGCTGGGAGGAGGAGGG + Intronic
901210188 1:7520241-7520263 AGGAGGAGGAGGGAAGAGGAGGG - Intronic
901248191 1:7750279-7750301 ATGAGGAGGTGAAATGAGGGAGG - Intronic
901329082 1:8390779-8390801 ATGGGGAGGTAAGTTTAGGAGGG - Intronic
901344805 1:8530497-8530519 ATGGGGAGGCGGGGCGGGGAGGG + Intronic
901876303 1:12168730-12168752 GTGGGGAGCAGGGATGAGGGAGG - Intronic
902007165 1:13241548-13241570 AAGGGGAGGTGTGATGAGAAAGG + Intergenic
902024840 1:13375182-13375204 TAAGGGAGGTGGGATTAGGAAGG - Intergenic
902026215 1:13385848-13385870 AAGGGGAGGTGTGATGAGAAAGG + Intergenic
902218090 1:14947284-14947306 AGAGGGAGGATGGATGAGGATGG + Intronic
902238757 1:15074474-15074496 ATAGGGAGGAGGGGTGAGCAGGG - Intronic
902440138 1:16423981-16424003 AGTGGGAGGGGGGATGAGAAAGG + Intronic
902471401 1:16649277-16649299 AGGGGAAGGTGGGATGAGACTGG - Intergenic
902517633 1:16997875-16997897 AAGGGGAGGGGGAAGGAGGAGGG + Intronic
902550879 1:17218910-17218932 ATGAGGTGGTGGGAGGAGGGAGG + Intronic
902595839 1:17508933-17508955 ATGGAGAGGTAGGGGGAGGAAGG - Intergenic
902648984 1:17824140-17824162 ATGGTGAGGTTGGAGGAGGCTGG + Intronic
902729202 1:18357462-18357484 ATGGAGATGGGGGATGAGGTGGG + Intronic
902798395 1:18814552-18814574 GTGGGGAAGTGGGAAGAGAAAGG - Intergenic
902838071 1:19059363-19059385 AGGGGGGGGTGGGAGGAGGAAGG + Intergenic
902841245 1:19075329-19075351 AGGAGGAGGTGGGCAGAGGAAGG - Intronic
902996451 1:20229181-20229203 ATAGGGAGGTGGGATGAAATGGG + Intergenic
902996594 1:20230327-20230349 ATAGGGAGGTGGGATGAAATGGG - Intergenic
903022839 1:20405988-20406010 GTGGGGAGGGGGGATTAGCAGGG + Intergenic
903059245 1:20658154-20658176 ATGGGGAAGTGGGTTCAGAAGGG - Intronic
903139781 1:21332588-21332610 AGGGGGAGGGGGGAGGAGGGGGG + Intronic
903210538 1:21815773-21815795 ATGGGGAGGAGGGTGGAGGATGG - Intronic
903262145 1:22137121-22137143 GGAGGGAGGTGGGAGGAGGAAGG - Intronic
903966802 1:27095851-27095873 ATGGGGAGTGTGGATGTGGAAGG - Intergenic
904336151 1:29799679-29799701 ATGGGGCAGTGGGCTGGGGAAGG + Intergenic
904492961 1:30871611-30871633 CTGGGCAGGTGGGCTGAGGTTGG + Intronic
904557359 1:31373816-31373838 ATGGTGGGGTGGGGTGGGGACGG - Intronic
904614679 1:31743344-31743366 AGGGGTGGGTGGGATGGGGAGGG - Intronic
905796923 1:40821028-40821050 CTGGGGAGGAGAGATAAGGAAGG - Intronic
905830193 1:41059500-41059522 ATGGGGAGCTGGAAAGGGGATGG - Intronic
905852704 1:41285989-41286011 AGGAGGAGGTGTGAAGAGGAAGG + Intergenic
905924794 1:41741688-41741710 ATGGGGCGTCGGGATGAGAAGGG + Intronic
906069961 1:43008920-43008942 ATGGGAATGTGGGAGGAGGAGGG + Intergenic
906142361 1:43541175-43541197 CTGGGGAGGTGAGATGGGGGAGG + Intronic
906190508 1:43896199-43896221 ATGGTGGGGTGGGATGGGCAGGG - Intronic
906535633 1:46549551-46549573 GTGGGGAGCTGAGATGAGGTGGG + Intronic
906536948 1:46556325-46556347 CTGGGGAGGTGGGCTGAGAAAGG + Intergenic
906708132 1:47909780-47909802 AAGGGGGGGGGGGATGGGGAGGG - Intronic
906860497 1:49353882-49353904 TTGGGGAGCTGGAAAGAGGATGG - Intronic
906901902 1:49844610-49844632 GTGGTGAGATGGGAAGAGGAAGG - Intronic
906954180 1:50358854-50358876 ATGGAGAGGAGGGAAGAGCAGGG + Intergenic
907016770 1:51023221-51023243 ATGGGGTGGGGGGATGGGGGAGG - Intergenic
907189762 1:52638795-52638817 ATGGGCTGGTGGGGTAAGGAAGG + Intronic
907213415 1:52842603-52842625 CTGGGGAGGCGGGAGGAGAACGG + Intronic
907308063 1:53524608-53524630 AAGGGCAGGTGGGAAGTGGACGG + Intronic
907398439 1:54208848-54208870 GTGGGGAGTTGGGATGGGGAGGG + Intronic
907442278 1:54486560-54486582 ATGGTGAGGTGGGGTGTGGTGGG - Intergenic
907704934 1:56824819-56824841 ATAGGGAGGTGGGATGTGGCAGG + Intergenic
908324661 1:63012049-63012071 ATGGAGAGGTAGGAAGAGGGAGG - Intergenic
908471429 1:64447633-64447655 CTGGGAAGGTGGGATGAAGGGGG + Intergenic
908821129 1:68087738-68087760 ATGGGGTGGGGGGATGGGGGAGG - Intergenic
908896777 1:68909963-68909985 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
908945117 1:69486436-69486458 GTGGGGTGGTGGGAGGAGGGAGG - Intergenic
909086447 1:71174281-71174303 GTGGGGAGCTGGAAGGAGGATGG + Intergenic
909087606 1:71186349-71186371 ATGGGGTGGGGGGAGGGGGAAGG - Intergenic
909393093 1:75137034-75137056 GTGGGTAGGTGGGATGCGAAGGG + Intronic
909594537 1:77391183-77391205 ATGGGCAGGTAGGATGATTATGG + Intronic
909685110 1:78339294-78339316 ATGGGGAGGTGGGATGAGGAAGG - Intronic
909816616 1:80002266-80002288 ATGGGGTGGGGGGCTGAGGGAGG + Intergenic
910149623 1:84126342-84126364 ATGGGGAGCTGGAAAGCGGATGG + Intronic
910333018 1:86097568-86097590 AGGAGGAGGGGGGAGGAGGAGGG - Intronic
910608308 1:89111629-89111651 ATGGGGTGGTGGGGGGAGGGAGG + Intronic
910630009 1:89344631-89344653 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
910698931 1:90051169-90051191 ATGCAGAGGAGGGATGAAGAAGG - Intergenic
910854390 1:91680228-91680250 ATGAGGAAGTGGGAGGAGAAAGG - Intergenic
910929184 1:92425684-92425706 CTGGGGAGATGAGGTGAGGATGG + Intergenic
910942360 1:92550346-92550368 ATGGGGTGGGGGGAGGGGGAGGG + Intronic
911179517 1:94848494-94848516 CTAAGGAGGTGGGAAGAGGAGGG - Intronic
911335439 1:96575177-96575199 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
911649912 1:100376151-100376173 ATGGGGTGGGGGGATGGGGGAGG + Intronic
911658105 1:100467605-100467627 CTGGGGGGTTGGGATGAGGGTGG - Intronic
911665255 1:100543964-100543986 ATGGTGAGGAGGGAGTAGGATGG + Intergenic
911995216 1:104758075-104758097 ATGGGGAGGGGGGATGGGGGAGG + Intergenic
912086877 1:106017663-106017685 GTGGGGGGGTGGGAGGAGGGAGG + Intergenic
912126507 1:106545750-106545772 ATGGGGTGGGGGGATGGGGGAGG - Intergenic
912319129 1:108693353-108693375 GTGGGGTGGGGGGATGAGGGTGG + Intronic
912499363 1:110111891-110111913 GTGAGGATGTGAGATGAGGACGG - Intergenic
912594511 1:110860636-110860658 ATGGGGTGGGGGGAGGGGGAGGG - Intergenic
912613499 1:111073667-111073689 ATGGGGTGGGGGAATGGGGAGGG - Intergenic
912648057 1:111414062-111414084 AAGGGGAGCTGAGATGGGGAGGG - Intergenic
912928166 1:113930793-113930815 TTGGGGAGGGGGGTTCAGGATGG + Intronic
913083593 1:115413117-115413139 AGGAGGAGGAGGGAGGAGGAGGG + Intergenic
913287698 1:117241691-117241713 CTCAGGAGGTGGGAGGAGGAGGG - Intergenic
913519536 1:119631868-119631890 AGGGGGGCGTGGGAAGAGGAGGG - Intronic
913638898 1:120791646-120791668 GTGGGGTGGTGGGATGGGGGAGG + Intergenic
913666418 1:121052495-121052517 ATGGGCAGGTGGCACCAGGAAGG + Intergenic
913930744 1:124961979-124962001 ATGGGGTGGGGGGAGGGGGAAGG - Intergenic
914196802 1:145451951-145451973 AGAGGGAGGCGGGAAGAGGAGGG + Intergenic
914805042 1:150985488-150985510 AAGGGGTGGTAAGATGAGGATGG - Intronic
914916669 1:151823287-151823309 ATGGGGAGGTGGGAGGCCGAGGG - Intronic
914959588 1:152194655-152194677 ATGGGGAGGGGTGAGGAGGGGGG - Intergenic
915035311 1:152918736-152918758 AGGAGGAGGAGGGAGGAGGAGGG + Intergenic
915248239 1:154570916-154570938 AGGGGGTGGTGGGTGGAGGAAGG - Intronic
915262067 1:154684149-154684171 TGGGGGGGGGGGGATGAGGAAGG + Intergenic
915444297 1:155966200-155966222 ATGGGGATGAGGGCTGGGGATGG - Intronic
915614382 1:157025496-157025518 GTGGGGAGGGGTGCTGAGGAGGG - Intronic
915616470 1:157043356-157043378 ATGGGGAGAAGCGTTGAGGAGGG + Intronic
916060454 1:161094901-161094923 ATGGAGAGGTGGAATAAGGATGG - Intergenic
916620201 1:166488792-166488814 GTGGGGAAGTTGGAAGAGGATGG - Intergenic
916866399 1:168864050-168864072 AAGGGGAGGGGGGATAAGGATGG + Intergenic
916930715 1:169575716-169575738 TTGGGGAGCTGGGTGGAGGAGGG + Intronic
916951576 1:169785489-169785511 ATGGGGAGCTGGAAGGGGGATGG + Intronic
917212835 1:172647458-172647480 GTGAGGAGGTGGGATAAGGTGGG - Intergenic
917265124 1:173212540-173212562 ACGGGGAGGAGGGAGGAGGTGGG + Intergenic
917306039 1:173626607-173626629 GTCGGGGGGTGGGATGGGGAGGG - Intronic
917364603 1:174216151-174216173 GTGGGAAGGTGGGATGGGTAAGG + Intronic
917499899 1:175576618-175576640 ATGGTGTGGTGGGATGATGATGG - Intronic
917555259 1:176079479-176079501 ATGGGGAGGTGGGAGAGGGCAGG + Intronic
917589195 1:176459637-176459659 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
917607635 1:176650550-176650572 ATGGGGTGGGGGGATGTGGGAGG - Intronic
917794037 1:178520187-178520209 TTGGGGAAGGGGGATGAGGAAGG + Intronic
917802074 1:178580563-178580585 CTGAGGAGGAGGGATGGGGAGGG - Intergenic
917803532 1:178592950-178592972 ATGGGGTGGGGGGAGGGGGAGGG + Intergenic
917869717 1:179230003-179230025 AGGTGGAGGTGGGATGGGGAAGG - Intergenic
918196305 1:182225569-182225591 GTGGGGAGGAGGGATAAAGAGGG - Intergenic
918403129 1:184184579-184184601 ATGGGGTGGGGGGATGGGGGAGG - Intergenic
918831999 1:189410777-189410799 ATCGGGTGGGGGGATGGGGAAGG - Intergenic
919113919 1:193257372-193257394 AGGGGGAGGTGGTCAGAGGATGG + Intergenic
919176715 1:194028416-194028438 AGGGGGAGGAAGGAGGAGGAAGG - Intergenic
919457952 1:197842214-197842236 ATGTGGAGGAGGGAAGAGGAAGG + Intergenic
919920838 1:202165626-202165648 CAGGTGAGGTGGGATGAGGGTGG + Intergenic
920275252 1:204799697-204799719 ATAGAGAGGTGGGAGAAGGAGGG - Intergenic
920350799 1:205336744-205336766 ATGGGCATGTGTGATGGGGAAGG - Exonic
920369522 1:205469304-205469326 ATGGGGCTGTGGGCTGGGGAAGG - Intergenic
920380256 1:205530877-205530899 CTGGGGTGGAGGGTTGAGGAGGG - Intronic
920578208 1:207078843-207078865 ATGGGGAGGTTGAGGGAGGAGGG + Intronic
920921201 1:210298617-210298639 ATGGGGAGCTGGGGAGGGGATGG + Intergenic
920945652 1:210526074-210526096 AATGGGAGGTGGGAAGAGGTGGG + Intronic
920983210 1:210857950-210857972 AGGGGTAGAAGGGATGAGGAAGG + Intronic
921239235 1:213160848-213160870 ATGGGGTGGGGGGATGGGGGAGG + Intronic
921261958 1:213392408-213392430 ATTGGCAGGTGGGAGGAGGAGGG + Intergenic
921365681 1:214371434-214371456 AAGAGGAGGAGGGATGAGGCAGG + Intronic
921394481 1:214654064-214654086 AGGAGGAGGGGGAATGAGGATGG - Intronic
921430711 1:215062512-215062534 AGGGGAAGGTGGGATGAACATGG + Intronic
921439549 1:215168701-215168723 AAGGGGTGGTGGGAAGGGGAGGG + Intronic
921447889 1:215268124-215268146 ATGGGGAGTTAGAATAAGGATGG - Intergenic
921543703 1:216449611-216449633 ATGGGGAGGTGGGAGGAGATTGG + Intergenic
921632884 1:217456015-217456037 ATGGGGAGCTGGGAAGGGGACGG - Intronic
921747772 1:218756932-218756954 ATGGGGATGTGAAATGAGGATGG + Intergenic
921969339 1:221129203-221129225 ATGGGAAGGAAGGAGGAGGAGGG + Intergenic
921969796 1:221135653-221135675 ATGGGTAGGTTGGAAGTGGAAGG - Intergenic
922223858 1:223628449-223628471 TAGGGGAGCTGGGAAGAGGATGG + Intronic
922224231 1:223631427-223631449 CTGGGGAGGTGTGAGGAGGAAGG - Intronic
922334298 1:224606376-224606398 ATGGGGAGCTGGAAAGGGGATGG + Intronic
922414480 1:225408192-225408214 ATGGGAAGGTGGGAAGGGTAGGG - Intronic
922461719 1:225818493-225818515 TTAGGGAGGTGGGAAGGGGAGGG + Intronic
922994517 1:229945189-229945211 ATGGGGAATTGGGGTGAGGAGGG - Intergenic
923009352 1:230075775-230075797 ATGGGGATTAGGGATGAGGGCGG + Intronic
923482474 1:234397506-234397528 AGGGGGAAGGGGGATGGGGAAGG + Intronic
923792580 1:237124809-237124831 GTGGGGAGATGGGATGGGGGTGG - Intronic
923968096 1:239166320-239166342 ATGGGGTGGGGGGATGGGGGAGG + Intergenic
923975481 1:239257319-239257341 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
923996454 1:239500465-239500487 ATGGGGTGGGGGGATGGGGGAGG + Intronic
924207112 1:241724980-241725002 ATAGGGAGGCAGGCTGAGGAAGG - Intronic
924247228 1:242096885-242096907 AGGGGGAGGGGGAAGGAGGAGGG - Intronic
924632079 1:245750717-245750739 ATGGGGGGGTGGGGTGGGGTGGG + Intronic
924880506 1:248157026-248157048 ATGGGGTGGAGGGAGGGGGAAGG - Intergenic
924908433 1:248482067-248482089 ATGGTGGGGTGGGGTGGGGAGGG + Intergenic
924915677 1:248566018-248566040 ATGGTGGGGTGGGGTGGGGAGGG - Intergenic
1062826349 10:571554-571576 ATGGGGAAGTGCAGTGAGGAAGG - Intronic
1063116736 10:3076920-3076942 ATGGGGAGGTGGGATGCCAAAGG - Intronic
1063159458 10:3408766-3408788 AGGAGGAGGAGGGAGGAGGAGGG + Intergenic
1063191289 10:3697222-3697244 CTGGGGAGGAGGAATGAGGATGG - Intergenic
1063259646 10:4372129-4372151 GCTGGGAGGTGGTATGAGGAAGG + Intergenic
1063311616 10:4957840-4957862 AAAGGGAGATGGGAAGAGGATGG - Intronic
1063338544 10:5240736-5240758 GTGGGGTGGGGGGATGGGGAAGG + Intergenic
1063367485 10:5499925-5499947 AGGGGGAGGTGGCTTGAAGAGGG + Intergenic
1063523401 10:6761120-6761142 ATGGGGAGTTGGAAGGGGGATGG - Intergenic
1063906430 10:10784493-10784515 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1063980096 10:11445813-11445835 TTGGGGAGATGGGAGGAGCAGGG - Intergenic
1063996650 10:11626165-11626187 ATAGGGAGATGGGAGGAGGAAGG + Intergenic
1064319941 10:14295625-14295647 ATGGTGAGAGGAGATGAGGAGGG + Intronic
1064674897 10:17750665-17750687 TTGGGGTTGTGGGAAGAGGATGG - Intergenic
1064704853 10:18061028-18061050 GTGGGGAGGAGGGATAAAGAGGG + Intergenic
1064737770 10:18400551-18400573 AGGGGGAGGGGGGAGGCGGAGGG - Intronic
1064785268 10:18887986-18888008 ATGGAGAGCTGGGAAGGGGATGG - Intergenic
1064881112 10:20054699-20054721 ATTGTGAGGTGGGGTGAGGGGGG + Intronic
1065009138 10:21405964-21405986 ATGGGGAGTTGGAAAGGGGATGG - Intergenic
1065325721 10:24549386-24549408 TTTGGTTGGTGGGATGAGGAAGG - Intergenic
1065327608 10:24563054-24563076 GTGGGGAGGAGGGATTAGAAAGG - Intergenic
1065454402 10:25891951-25891973 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1066251471 10:33637281-33637303 ATGGGGAGTTGGAAAGGGGATGG - Intergenic
1066297442 10:34067247-34067269 ATGAGGAAGTGGGCTGAGTAGGG - Intergenic
1066334650 10:34463259-34463281 AAGGGGAAGGGGGAAGAGGAAGG + Intronic
1066363730 10:34756112-34756134 ATGGGGAGATTGGAGGAGGGAGG - Intronic
1066481300 10:35798241-35798263 AAGGGGAGCTGAGATCAGGAAGG + Intergenic
1067256475 10:44647461-44647483 ATGGGGAGATGGGGTGGGGATGG - Intergenic
1067267234 10:44756999-44757021 ATGGGGAGGTGAGAAGGGGATGG - Intergenic
1067267243 10:44757027-44757049 ATGGGGAGGTGAGAGGGGGATGG - Intergenic
1067267270 10:44757103-44757125 ATGAGGAGGTGAGAAGGGGATGG - Intergenic
1067295298 10:44972171-44972193 ATGGTGTGATGGGCTGAGGACGG - Intronic
1067427093 10:46218651-46218673 ATGGTGGGGTGAGCTGAGGATGG + Intergenic
1067427107 10:46218727-46218749 ATGGTGGGGTGAGCTGAGGATGG + Intergenic
1067427115 10:46218765-46218787 ATGGTGGGGTGAGCTGAGGATGG + Intergenic
1067427132 10:46218860-46218882 ATGGTGGGGTGAGCTGAGGATGG + Intergenic
1067427140 10:46218898-46218920 ATGGTGGGGTGAGCTGAGGATGG + Intergenic
1067427145 10:46218917-46218939 ATGGTGGGGTGAGCTGAGGATGG + Intergenic
1067427150 10:46218936-46218958 ATGGTGGGGTGAGCTGAGGATGG + Intergenic
1067427158 10:46218974-46218996 ATGGTGGGGTGAGCTGAGGATGG + Intergenic
1067427163 10:46218993-46219015 ATGGTGGAGTGGGCTGAGGATGG + Intergenic
1067427172 10:46219031-46219053 ATGGTGGAGTGGGCTGAGGATGG + Intergenic
1067488897 10:46679238-46679260 GTGGAAAGGAGGGATGAGGAAGG - Intergenic
1067582589 10:47454823-47454845 ATGGTGGAGTGGGCTGAGGATGG + Intergenic
1067605771 10:47661138-47661160 GTGGAAAGGAGGGATGAGGAAGG + Intergenic
1067698946 10:48555056-48555078 ATTGGGATGTGGCAGGAGGAAGG - Intronic
1067773007 10:49140566-49140588 GTGGGGAGGTGTGGTGGGGATGG - Intergenic
1067897627 10:50201161-50201183 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1067910593 10:50342945-50342967 TTGGGTAGGTGGGAAGTGGATGG - Intronic
1067973469 10:50996923-50996945 AAGGGGAGGAAGGCTGAGGAAGG + Intronic
1067978788 10:51057538-51057560 ATTGGGAAATGGCATGAGGAAGG - Intronic
1068497902 10:57808387-57808409 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1069159621 10:65078251-65078273 GTGGGGTGGGGGGAGGAGGAAGG - Intergenic
1069727126 10:70587291-70587313 GTGGGAAGGTGGGCTCAGGAAGG + Intergenic
1070339700 10:75486543-75486565 ATTTTGAGGTGGGATGAGGAAGG + Intronic
1070531270 10:77339519-77339541 GTGGGGAGGTGGGGTGAGGCAGG - Intronic
1070645461 10:78199147-78199169 TTGGGGGGGCGGGAAGAGGAGGG - Intergenic
1070686832 10:78491191-78491213 CTGGACAGGTGGGAAGAGGAAGG + Intergenic
1070688805 10:78509679-78509701 CTGGGGCTGGGGGATGAGGAGGG - Intergenic
1071104672 10:82080459-82080481 ATGGGAAGGTGGCAGAAGGAGGG - Intronic
1071326164 10:84520543-84520565 GTGGGGAGGTGGGATAAAGAGGG - Intergenic
1071371070 10:84952400-84952422 ATGGGGTGGTGGAGAGAGGAGGG + Intergenic
1071621330 10:87122497-87122519 GTGGAAAGGAGGGATGAGGAAGG + Intronic
1071760846 10:88604680-88604702 ATAGGGAGGTTTGATGATGAAGG + Intronic
1071793297 10:88979213-88979235 CTGGGGAGGAGAGATAAGGAAGG + Intronic
1072274809 10:93812700-93812722 TGGCTGAGGTGGGATGAGGAGGG - Intergenic
1072609031 10:97004479-97004501 AGGTGGTGGTGGGATGGGGAAGG + Intronic
1072662676 10:97372248-97372270 ATGGGGAGGTGGGAGAAGTCAGG + Intronic
1072836581 10:98721434-98721456 AGGGGGTGGTGGGATGGGGAAGG - Intronic
1072875030 10:99163417-99163439 CTGAGGAGGTGGAAAGAGGAAGG - Intronic
1073112284 10:101069924-101069946 ATGGGGTGGTGGGATAGAGAAGG + Intergenic
1073224176 10:101902696-101902718 AGCGGGAGGTGGGAAAAGGAGGG + Intronic
1073327386 10:102650632-102650654 ATGGGGCGGTGGCATGTGTAAGG + Intronic
1073327801 10:102652297-102652319 ATGGGCTGGCGGGGTGAGGAAGG + Intronic
1073332971 10:102682892-102682914 TTGGGGAGGTGGGGTGGGGTAGG + Intronic
1073339623 10:102735154-102735176 GAGGGGAGGAGGGATGAGGAGGG - Intronic
1073403776 10:103278848-103278870 TTGGGGAGGTGGGTAGAGCAGGG - Intronic
1073597718 10:104817400-104817422 AGGGGGAAGGGGGAGGAGGAGGG - Intronic
1073610211 10:104935738-104935760 ATGGTGGGGTGGGTTGGGGAGGG + Intronic
1073966966 10:109001401-109001423 ATGGGGAGGGGGGTTGAAGGTGG - Intergenic
1074065334 10:110008146-110008168 AAGGGGAGGGGGCTTGAGGAGGG - Exonic
1074145935 10:110717344-110717366 CTGGAGAGGAGGGAGGAGGAGGG - Intronic
1074162656 10:110846893-110846915 ATGTGGAGCTGGAAGGAGGAAGG - Intergenic
1074217220 10:111397587-111397609 AAGGGAAGGTGAGAGGAGGAAGG + Intergenic
1074252915 10:111770616-111770638 GTGGGGTGGGGGGATGGGGAGGG + Intergenic
1074311650 10:112327791-112327813 AGGGGGAGGAGGGAAGAGGGAGG + Intergenic
1074524653 10:114253214-114253236 ACGGGGAGGGGGGACGGGGAGGG - Intronic
1074652513 10:115539979-115540001 ATGGGGTGGGGGGAGGGGGAGGG + Intronic
1074716886 10:116228148-116228170 ATGGGGTGGTGGGAGGAGAGTGG - Intronic
1074887239 10:117703827-117703849 AGGAAGAGCTGGGATGAGGATGG - Intergenic
1074948483 10:118304395-118304417 ATGGTGATGTGGGATGAAGAAGG - Exonic
1075048761 10:119166316-119166338 AAGGGCAGGTGGGAGGAGGAAGG - Intergenic
1075149098 10:119910643-119910665 ATGGAGAGGAGAAATGAGGAAGG - Intronic
1075222927 10:120600434-120600456 GTGGGGAGGTGGGAGCAGGTGGG + Intergenic
1075389936 10:122084739-122084761 ATGGGCAGCTGTGATGGGGAGGG + Exonic
1075592858 10:123705029-123705051 CTGGGCAGGCGGGATGGGGAAGG + Intergenic
1075606240 10:123812821-123812843 GTGGGGATGGGGGATGGGGAAGG - Intronic
1075627363 10:123972602-123972624 ATGGGGAGAAGGGAGGAGCAGGG + Intergenic
1075799831 10:125146687-125146709 ATGGCAAGGTGGGGTAAGGAAGG - Intronic
1076081631 10:127586869-127586891 ATGGGGAAGTGGTACCAGGAAGG - Intergenic
1076117178 10:127908440-127908462 GTGGGGAGGGGGGGTGTGGAGGG + Intronic
1076136849 10:128051140-128051162 AAGGGGAAATGGGATGAGAAGGG - Intronic
1076318886 10:129564230-129564252 AGGGGGAAGGGGGAAGAGGAGGG - Intronic
1076319481 10:129567312-129567334 ATGGGGACATGGGATGGGGGTGG - Intronic
1076802252 10:132836033-132836055 AGGGGGAGGTGAGAGGTGGAGGG - Intronic
1076857240 10:133123447-133123469 GTGTGGATGTGGCATGAGGACGG - Intronic
1076989850 11:267340-267362 AGGGGGAGGAGCGAGGAGGAGGG + Intergenic
1077204556 11:1336363-1336385 CAGGGGAGGTGGGAGGAGGGAGG - Intergenic
1077392560 11:2306874-2306896 AGGGGGAGAAGGGAAGAGGAGGG + Intronic
1077448264 11:2613792-2613814 ATGGGTAGGGGGAATTAGGATGG - Intronic
1077475939 11:2790525-2790547 ATGGGAAGGGGGGATGGGAAAGG - Intronic
1077761751 11:5107726-5107748 AGGGGGAGGGGGGAGGAGGAAGG + Intergenic
1077921847 11:6647285-6647307 AAGGGGAGGTGAGTTGAGGCAGG + Intronic
1078138507 11:8672731-8672753 AGGCTGAGGTGGGATGAGGTGGG - Intergenic
1078153461 11:8778408-8778430 AGGGGGAGGGTGGATGTGGACGG - Intronic
1078703685 11:13717144-13717166 ATGGGGAGGCGCGAGGGGGAAGG - Intronic
1078727877 11:13948046-13948068 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1078728117 11:13950597-13950619 ATGGGGTGGGGGGAGGGGGAGGG - Intergenic
1079089300 11:17469544-17469566 AGGGGGAGGTGGGCTGTGGTGGG - Intronic
1079360281 11:19765323-19765345 AAGAGGAGGAAGGATGAGGAAGG - Intronic
1079376541 11:19897232-19897254 GTGGGGTGGGGGGAGGAGGAGGG + Intronic
1079429358 11:20374119-20374141 ATGGGAAAGGAGGATGAGGAAGG + Intronic
1079465579 11:20726738-20726760 ATGGGGTGGGGGGATGGGGGAGG - Intronic
1079660910 11:23035552-23035574 AAGGGGAGGTGGAAAGAGGATGG - Intergenic
1080237897 11:30092864-30092886 AGGAGGAGGAGGGAGGAGGAGGG - Intergenic
1080723830 11:34875094-34875116 ATGGGGAGCTGGAAAGAGGATGG - Intronic
1080878151 11:36295339-36295361 ATGAGGAGATGGTATGGGGATGG - Intergenic
1081312812 11:41593994-41594016 ATGGGGAGCTGGGAAGAGGATGG + Intergenic
1081485968 11:43529189-43529211 GTGGGGTGGTGGGAGGGGGAGGG + Intergenic
1081633184 11:44703027-44703049 GTGGGGAGGTGGGGTGGGGATGG + Intergenic
1081670620 11:44940231-44940253 ATGGGGAGGCTGGAAGAGGAAGG - Intronic
1082010485 11:47446975-47446997 GTAGGGAGGTGAGAGGAGGAGGG - Intronic
1082173945 11:49040343-49040365 ATGGGGTGGGGGGAGGGGGAGGG - Intergenic
1082622421 11:55440381-55440403 GTGGGGTGGTGGGAGGAGGAGGG - Intergenic
1082671779 11:56043675-56043697 ATGGGGAAGAGGTATGTGGATGG + Intergenic
1082701834 11:56441766-56441788 AAGGGGAGCTGAGAAGAGGATGG + Intergenic
1082891040 11:58139043-58139065 CTGGGAAGATGGGAGGAGGAAGG + Intronic
1082892401 11:58154095-58154117 AAGGGGAGGAGGAAGGAGGAGGG + Intronic
1082915682 11:58433904-58433926 GTGGGGAGGGGGGAGGGGGAGGG + Intergenic
1082932958 11:58628227-58628249 CAGTGGAGGTGGGATGAGGCAGG - Intergenic
1083009027 11:59376689-59376711 GTGGGGTGGTGGGATGGGGGAGG + Intergenic
1083433448 11:62627033-62627055 AAGGGGAGGTGAGTTAAGGAAGG - Exonic
1083913049 11:65721023-65721045 AGGGGGAGGGGGGAGGGGGAAGG - Intergenic
1084817005 11:71654023-71654045 ATGTGCAGGTGGAATGAAGAGGG + Intergenic
1084958341 11:72703258-72703280 AAGGGGAGGAGGGGTGAGCAGGG + Intronic
1085129551 11:74026394-74026416 CTGAGGAGGTTGGAAGAGGATGG + Intronic
1085326568 11:75610975-75610997 GTGAGGAGGAGGGGTGAGGAAGG - Intronic
1085344997 11:75762958-75762980 ATTGGGGGGTGGGGTGAGGGTGG - Intronic
1085502660 11:77037978-77038000 AGGGGGAAGAGGGAGGAGGAGGG + Intronic
1085596908 11:77819766-77819788 TGGGGGAGGTGGGGAGAGGAAGG + Intronic
1086286859 11:85261381-85261403 ATGGGGAGGTGTGGTGGGGGTGG - Intronic
1086418667 11:86615700-86615722 ATGGGAAGTTGAGAAGAGGAAGG - Intronic
1086691820 11:89795736-89795758 ATGGGGTGGGGGGAGGGGGAGGG + Intergenic
1086713982 11:90043918-90043940 ATGGGGTGGGGGGAGGGGGAGGG - Intergenic
1086854317 11:91848391-91848413 ATGGGGTGGAGGGATGGGGGAGG - Intergenic
1086978956 11:93172587-93172609 GTGGGGTGGGGGGATGGGGAGGG - Intronic
1087158930 11:94930342-94930364 ATGGGGAGGTGGGAGAATGAAGG + Intergenic
1087559056 11:99761407-99761429 GTGGGGTGGTGGGAGGGGGATGG - Intronic
1087944005 11:104136038-104136060 CAGGTGAGATGGGATGAGGAGGG + Intronic
1088450618 11:109977747-109977769 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1088562431 11:111129037-111129059 ATGAGGAGGTGGGGGAAGGAAGG - Intergenic
1088820662 11:113453931-113453953 ATGGGGGGCTGGGGGGAGGATGG + Intronic
1089009200 11:115119059-115119081 ATGGGGGGTTGGGAAGTGGAGGG + Intergenic
1089137453 11:116261110-116261132 ATGGGGTGGGGAGAGGAGGAGGG - Intergenic
1089156751 11:116408738-116408760 CGGGGGAGGTGGGGGGAGGAAGG - Intergenic
1089272043 11:117308045-117308067 TTGGGGCGGGGGGATGGGGATGG + Intronic
1089297960 11:117481133-117481155 CTGGGGAGGTGGGATGGGAAGGG + Intronic
1089324442 11:117647656-117647678 AAAGGGAAGGGGGATGAGGAGGG + Intronic
1089406487 11:118201880-118201902 TTGGGGAGATGGGCTGAGGAGGG + Intronic
1089611862 11:119673711-119673733 AGGGGGAGGTGGGAAGGGCAGGG - Intronic
1089613987 11:119684974-119684996 ATGGGGAGGAGGGCTCAGCAAGG + Intronic
1089631962 11:119789464-119789486 AGGGGCAGGTAGGAAGAGGAGGG + Intergenic
1089833393 11:121348869-121348891 GTAGTGAGGTGGGGTGAGGAAGG + Intergenic
1090254424 11:125273366-125273388 ATGGGCAGATGGGAGAAGGAGGG + Intronic
1090359354 11:126161778-126161800 ATGGGGTGGGGGGAGGGGGAGGG - Intergenic
1090554123 11:127855597-127855619 ATGGGGAGCTAGAAAGAGGATGG + Intergenic
1090678912 11:129031994-129032016 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1090687678 11:129141471-129141493 ATGGGGTAGGGGGATGGGGAAGG + Intronic
1090805510 11:130199705-130199727 AGGGGGAGGTGGGAAGATGAGGG + Intronic
1090856364 11:130612379-130612401 TTGGGGTGGAGGGATGAGGGGGG - Intergenic
1091197662 11:133745821-133745843 ATGGGGAGGAGAGAAAAGGAGGG - Intergenic
1091282005 11:134387199-134387221 AGGGGGAGGTGGGAAGTGGAGGG - Intronic
1091294114 11:134460545-134460567 ATGGGGAGCTGTGCTCAGGAGGG + Intergenic
1091303530 11:134523138-134523160 CTGGGGAGGTGGGAAGGGGGAGG - Intergenic
1091323886 11:134669892-134669914 ACAGGGAGGGGGGAGGAGGAGGG + Intergenic
1091343115 11:134835330-134835352 ATGGGGAGCTGGGGTGAAGGTGG - Intergenic
1091446333 12:546027-546049 ATGGGGAGGAGTGAGGAGTAGGG + Intronic
1091446407 12:546261-546283 GTGGGGAGGTGGGAGGAGTGGGG + Intronic
1091812891 12:3414720-3414742 ATGGGGAGTTGGAAAGGGGATGG + Intronic
1092045656 12:5430587-5430609 ATGGGGAGGTGGGAAGGGAGGGG - Intergenic
1092425993 12:8376042-8376064 ATGTGCAGGTGGAATGAAGAGGG - Intergenic
1093661960 12:21767568-21767590 ATGGGGGTGGGGGATGGGGATGG - Intronic
1093769100 12:22998980-22999002 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1093937760 12:25019410-25019432 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1094172421 12:27507662-27507684 TGGGAGAGGTGGGATGGGGATGG - Intergenic
1094443315 12:30503142-30503164 ATCGGGATGTTGGTTGAGGAAGG + Intergenic
1094555678 12:31497774-31497796 ATGGGGAGGGTGGAGGGGGAGGG + Intronic
1095086992 12:38067399-38067421 GTGGGGTGGTGGGAGGGGGAAGG + Intergenic
1095183836 12:39178402-39178424 ATGGGGAGCTGGTAGGGGGATGG - Intergenic
1095652880 12:44634314-44634336 ATGGGGTGGGGGGCTGGGGAAGG - Intronic
1095748097 12:45682162-45682184 ATGAGGAGGTGGAAGGGGGATGG - Intergenic
1095952233 12:47787887-47787909 ATGGGGAGGCTGGATGAGCTGGG - Intronic
1095952961 12:47791429-47791451 AGGTGGAGGTGGGCTGAGGAGGG + Intronic
1095953768 12:47795390-47795412 ATCGGGGGGTGGAATAAGGAGGG + Intronic
1095967564 12:47879195-47879217 TGGGGGCGGTGGGATGAGGCTGG - Intronic
1096160265 12:49370781-49370803 CTGGGCAGGTGGGAGGAGGTTGG - Intronic
1096381253 12:51159879-51159901 ATGGGGCTGAGGGATGTGGATGG + Intronic
1096439072 12:51623756-51623778 GTGGGGTGGGGGGAGGAGGAAGG - Intronic
1096576248 12:52554609-52554631 ATGGATGGGAGGGATGAGGAGGG - Intergenic
1096666789 12:53171453-53171475 AGGGGGCGGTGGCAAGAGGAAGG + Intronic
1096750642 12:53756753-53756775 CTGGGGAGGGGGGATGAGATGGG + Intergenic
1096989056 12:55783583-55783605 GGGGGGAGGTGGGAGGAGGTGGG + Intronic
1097153193 12:56994570-56994592 ATGGGGAGCTGTGAGGAGGCTGG - Exonic
1097409630 12:59235457-59235479 ATGGAGAGGTAGGGTGAAGAGGG - Intergenic
1097621782 12:61947306-61947328 GTGGGGAGGTGGGAGGGGGGAGG + Intronic
1097973732 12:65663009-65663031 TTGGGGAGGAGGGATTATGAGGG + Intergenic
1098314879 12:69182519-69182541 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1098553459 12:71791676-71791698 AAAGGGATGTGGGATGATGAGGG - Exonic
1098565409 12:71929659-71929681 GTGGGGAGGTGGGACAAAGAAGG + Intergenic
1098757671 12:74386958-74386980 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1098758334 12:74391671-74391693 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1098976578 12:76908484-76908506 ATGGTGAGGTGGGAGGAACAAGG - Intergenic
1099064940 12:77964010-77964032 AGGAGGAGGAGGGAAGAGGAGGG - Intronic
1099229012 12:80001653-80001675 ATGGGAATTTGGGATGGGGAGGG + Intergenic
1099427726 12:82545324-82545346 ATGGGGTGGGGGGATGGGGGAGG - Intergenic
1099575686 12:84377958-84377980 ATGGGGTGGGGGGATGGGGGAGG + Intergenic
1099626894 12:85087084-85087106 GTGGGGTGGGGGGATGGGGAGGG - Intronic
1099735871 12:86565669-86565691 TTGGGGAAGAGGGATGTGGATGG + Intronic
1099884051 12:88504969-88504991 ATGGGGTGGGGGGAGGGGGAAGG + Intronic
1099946833 12:89254638-89254660 ATGGGGAGGTTGGAAAGGGAGGG - Intergenic
1099959192 12:89380439-89380461 ATGGGAAGGAGGGAAGAGGGAGG - Intergenic
1100387012 12:94112949-94112971 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1100399521 12:94216842-94216864 AAGGGCAGGTGGGATGCAGAGGG - Intronic
1100463993 12:94828858-94828880 ATGGGGTGGCGGGAGGAGGGAGG + Intergenic
1101124324 12:101615349-101615371 AGGAGGAAGAGGGATGAGGAAGG - Intronic
1101378039 12:104187853-104187875 ATGGGGAGTTGGAAAGGGGATGG + Intergenic
1101421554 12:104555299-104555321 ATGGGGAGTGGAGATGAGTAGGG + Intronic
1101706532 12:107225735-107225757 AGGGGGAGGAAGGAGGAGGAGGG + Intergenic
1101743310 12:107518602-107518624 ATGGGGTGGGGGGAGGGGGAAGG + Intronic
1101794281 12:107958508-107958530 AGGTGGAGGTGGGATGAGAGTGG - Intergenic
1101843158 12:108342137-108342159 AGGAGGAGGAGGGAAGAGGAGGG + Intergenic
1102167835 12:110820676-110820698 CTGGGGAGAGGGGAGGAGGAGGG - Intergenic
1102383080 12:112483970-112483992 GGGTGGAGGTGGGATGCGGAGGG + Intronic
1102426243 12:112846521-112846543 ATGGGGAGGAGGGAGGAAGATGG + Intronic
1102714381 12:114957165-114957187 ATGGGGAAGTGAGATACGGAAGG + Intergenic
1102851217 12:116246854-116246876 GTGGGGAGGTGGGGAGAGGAGGG + Intronic
1102851233 12:116246892-116246914 GTGGGGAGGCGGGAAGAAGAGGG + Intronic
1103058891 12:117842982-117843004 TTGGGAAGGAGGGAGGAGGAAGG + Intronic
1103086057 12:118061993-118062015 ACGGGGCGGTGGGGAGAGGAGGG + Intronic
1103219472 12:119231874-119231896 AGGGGGAGGAGGGAGGAGGAAGG - Intergenic
1103240719 12:119411201-119411223 AAGGGGAGGTGTGCTTAGGAAGG + Intronic
1103458884 12:121088364-121088386 ATGCGGAAGTGGGAAGATGATGG - Intergenic
1103640498 12:122347620-122347642 AGGTGGAGGTGAGATGAGGTGGG + Intronic
1103960735 12:124607552-124607574 ATGTGGAGATGTGAGGAGGAGGG - Intergenic
1104143132 12:126007153-126007175 ATGGGGAGTTGGAAAGGGGATGG + Intergenic
1104280130 12:127369268-127369290 ATGATGAGGTGTGATGTGGAAGG - Intergenic
1104505992 12:129332854-129332876 CTGGGGAGGAGGGAAGAGGGAGG + Intronic
1105402137 13:20105215-20105237 ATGGGAAGGAGGGAAGAGGCTGG + Intergenic
1106004620 13:25757116-25757138 ATGGAGTGGTGGGAGGAGGGAGG + Intronic
1106124609 13:26890137-26890159 CTGGGGTGGGGGGAGGAGGAGGG - Intergenic
1106588880 13:31081159-31081181 ATGGGGAGGAGGGATGGAGAAGG + Intergenic
1107294389 13:38894320-38894342 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1107355465 13:39561165-39561187 ATGGGGAGTGGGGAGGAGGCAGG - Intronic
1107572320 13:41675927-41675949 AGGGGAAGGTGAGGTGAGGATGG + Intronic
1107577726 13:41745281-41745303 ATGGGGTGGGGGGATGCGGGAGG - Intronic
1107748894 13:43543128-43543150 ATGGGGACATGGAATGGGGAAGG + Intronic
1107943228 13:45393120-45393142 ATGGGGAGGGGGGTTGGGGGGGG + Intergenic
1108107229 13:47024405-47024427 ATGAGGATGTGGGATGTTGAGGG + Intergenic
1108159056 13:47618897-47618919 ATGGGGAGTTGGAAAGGGGATGG - Intergenic
1108254640 13:48598550-48598572 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1108265432 13:48702259-48702281 ATGGGGTGGGGGGAGGGGGAGGG + Intronic
1108603219 13:52012175-52012197 GTGGGGGGTTGGGCTGAGGAGGG - Intergenic
1108799810 13:54081728-54081750 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1108804269 13:54134462-54134484 ATGGGGTGGAGGGATCAGGGAGG + Intergenic
1109173526 13:59126269-59126291 TTGGGGTGGAGGGATGGGGAGGG - Intergenic
1110433900 13:75458209-75458231 ATGGGGAGCTGGAAAGAGGATGG + Intronic
1110554673 13:76844993-76845015 ATGGGGAGATGGGGAGATGATGG + Intergenic
1110597128 13:77331498-77331520 TTGGGGAGGGGAGATGGGGATGG - Intergenic
1110849199 13:80224648-80224670 ATGAGGAAGTTGGAGGAGGAGGG + Intergenic
1110910509 13:80956059-80956081 ATGGGAAGGTGGGAGGTGGGAGG + Intergenic
1111047604 13:82835157-82835179 GAAGGGAGGTGGGAAGAGGAAGG + Intergenic
1111073408 13:83200055-83200077 ATGGGGAGCTGGAAGGTGGATGG - Intergenic
1111451818 13:88428810-88428832 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1112171493 13:96977180-96977202 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1112177965 13:97047294-97047316 ATGAGGAGAAGGAATGAGGAGGG - Intergenic
1112226305 13:97543997-97544019 ATGGGGTGGTGGGGTGGGGGTGG - Intergenic
1112259765 13:97867666-97867688 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1112423911 13:99279090-99279112 AGAGGGAGGTGGGAAAAGGAAGG - Intronic
1112544647 13:100354332-100354354 AGGGGGCGGTGGGAGGAGGGAGG + Intronic
1112585035 13:100711558-100711580 ATATGGAGCTGGGATGAGCACGG - Intergenic
1112828366 13:103418466-103418488 ATGGGGTGGGGGGAGGGGGAGGG + Intergenic
1113092485 13:106630207-106630229 AAGGGGAGGTGTGACGAGTATGG + Intergenic
1113582824 13:111440788-111440810 ATGGAGAGGTGGGAAGGGGTGGG - Intergenic
1113595582 13:111529701-111529723 AGGGGGAGGGGGGAGGAGCAGGG - Intergenic
1113855998 13:113445762-113445784 ATGGGTTGGTGAGATTAGGAAGG + Intronic
1113936610 13:113998242-113998264 AGGGGGAGATGGGAAGAGGAGGG - Intronic
1114069551 14:19096694-19096716 TTAGGGAGTTGGGAAGAGGAAGG + Intergenic
1114092711 14:19303309-19303331 TTAGGGAGTTGGGAAGAGGAAGG - Intergenic
1114292663 14:21301315-21301337 ATGGGGTGGTGGGCAGAAGAAGG - Intronic
1114401285 14:22413228-22413250 AAGGGGAGGTCAGAAGAGGAAGG + Intergenic
1114547218 14:23512035-23512057 ATTGGGATGGGGGAGGAGGAAGG - Intergenic
1114553417 14:23547482-23547504 ATGTGGAGGAGGGAAGAGAAAGG - Intronic
1114684455 14:24514797-24514819 ATGTGGTGGTGAGAGGAGGAAGG + Intergenic
1114952910 14:27779426-27779448 GTGGGGAGGGGGGAGGGGGAGGG + Intergenic
1115379772 14:32722719-32722741 ATGGGGAGCTGGGAAGGCGATGG - Intronic
1115498184 14:34027232-34027254 AGGGGGAGGAGAGAGGAGGAGGG + Intronic
1115732605 14:36287601-36287623 AAGGGGAGGTGGGATGTGCCTGG + Intergenic
1116895330 14:50310589-50310611 TTGGGGAGGGGGGCTGAGGAGGG + Intronic
1117390357 14:55256544-55256566 ATGGAGAGCTGGAAAGAGGATGG - Intergenic
1117612487 14:57499144-57499166 ATGGGGTGGGGGGATGGGGAGGG - Intergenic
1117761655 14:59035412-59035434 AGGGGGAGGAGGGGGGAGGAGGG - Intergenic
1117943997 14:60998483-60998505 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1118095001 14:62526361-62526383 GTGGGGTGGGGGGATGGGGAGGG + Intergenic
1118407562 14:65441939-65441961 GTGGGGTTGTGGGAGGAGGAGGG - Intronic
1118638314 14:67768209-67768231 ATGGGGAGGTAGGATGGTAAAGG + Intronic
1118672615 14:68146092-68146114 GTGGGGAGGTGGAATGAGTTAGG + Intronic
1118749168 14:68794141-68794163 GTGGGGAGGATGGAGGAGGAGGG - Intronic
1118798423 14:69166824-69166846 AAGGGAAGGTAGGATGAGGCTGG + Intergenic
1119160331 14:72447035-72447057 AGGAAGAGGTGGGAGGAGGAAGG + Intronic
1119767461 14:77199436-77199458 CTGAAGAGGTGGGATGAGAAGGG - Intronic
1119768613 14:77206226-77206248 GTGGGGAGGTGGGAGGGGCAGGG + Intronic
1119818334 14:77591320-77591342 GTGGGGAGGGTGGATGAGGAAGG + Intronic
1119909270 14:78334979-78335001 ATGGGGAGGTGGATTGAAGGTGG + Intronic
1119913314 14:78371372-78371394 AAGGGGAGGTGGAAGGGGGATGG - Intronic
1120218376 14:81704993-81705015 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1120346224 14:83294013-83294035 AAGGGGAGGGGAGAGGAGGAAGG - Intergenic
1120680055 14:87470517-87470539 ACGGGAAGATGGGAGGAGGAAGG + Intergenic
1120726181 14:87944075-87944097 GTGGGGACGAGGGATGGGGAAGG - Intronic
1120937013 14:89907160-89907182 ATGGGGTGGTAGGATGTGCAGGG - Intronic
1120954668 14:90071477-90071499 GTGGGGAGATGGGACCAGGAGGG - Intronic
1120988539 14:90354976-90354998 ATGGGGAGGGGAAAGGAGGAGGG + Intergenic
1121010041 14:90514423-90514445 CTGGGGAAATGGGGTGAGGATGG + Intergenic
1121092803 14:91194504-91194526 TTAGGGAGGGGGGATGGGGAAGG + Intronic
1121153666 14:91663064-91663086 AGGTGGAGGAGGGAGGAGGAAGG - Intronic
1121585440 14:95060099-95060121 ATGGGGTGGTGGCAGGAGGATGG - Intergenic
1121622982 14:95363065-95363087 CAGGGAAGGTTGGATGAGGACGG - Intergenic
1121666519 14:95676626-95676648 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1121667836 14:95686278-95686300 AGGGGGAGGAGGGAGGAGGGAGG - Intergenic
1121713774 14:96058369-96058391 AGGGGGAGGTGAGTTGAGGTGGG - Intronic
1121956928 14:98222872-98222894 ATGGGGCTGGGGGATGTGGATGG - Intergenic
1122012292 14:98760188-98760210 GTGGGTATGTGGGGTGAGGAAGG - Intergenic
1122036098 14:98950407-98950429 AAGGGGAGGGGAGAGGAGGAAGG + Intergenic
1122068586 14:99190599-99190621 AAGGGAAGGAGGGAAGAGGAAGG + Intronic
1122254193 14:100464676-100464698 ATGGGGAGGGGAGATGAGGTAGG - Intronic
1122324786 14:100875634-100875656 TTGGGGAGGAGGGGTGAGAAAGG - Intergenic
1122761616 14:104032958-104032980 GAGGGGAGGTGGGATGAGGGTGG + Intronic
1122779591 14:104138171-104138193 ACGGCGAGGTGGGCCGAGGAAGG - Intergenic
1122782659 14:104150182-104150204 GTGGGGGAGGGGGATGAGGAGGG - Intronic
1123023801 14:105414389-105414411 ATGGAGAGGTGGGCAGAGAAGGG - Intronic
1123155291 14:106219005-106219027 ATGCTGAGCTGGGATGTGGAAGG - Intergenic
1123206722 14:106720697-106720719 ATGCTGAGCTGGGATGTGGAAGG - Intergenic
1123211744 14:106767702-106767724 ATGCTGAGCTGGGATGTGGAAGG - Intergenic
1123401957 15:19996132-19996154 ATGCTGAGCTGGGATGTGGAAGG - Intergenic
1123511298 15:21002796-21002818 ATGCTGAGCTGGGATGTGGAAGG - Intergenic
1123578129 15:21693567-21693589 ATGCTGAGCTGGGATGTGGAAGG - Intergenic
1123614754 15:22136049-22136071 ATGCTGAGCTGGGATGTGGAAGG - Intergenic
1124099414 15:26679501-26679523 GTAGGGAGGTGGGGTGAGGTAGG - Intronic
1124372303 15:29110708-29110730 AGGGGGAGAAGAGATGAGGAAGG + Intronic
1124795352 15:32772912-32772934 ATGTGGAGGCTGGATCAGGAAGG + Exonic
1124983916 15:34586687-34586709 ATGGGGTGGGGGGAGGGGGAGGG + Intronic
1125175909 15:36821600-36821622 ATGAGGAGATGTGATGAGGAAGG + Intergenic
1125402382 15:39318000-39318022 AGGAGGAGGAGGGAGGAGGATGG - Intergenic
1125426812 15:39556981-39557003 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1125446899 15:39767795-39767817 ATGGGGAGCTGGAACGGGGATGG - Intronic
1125456518 15:39865552-39865574 GTGAGGAGGTGGAAGGAGGATGG + Intronic
1125590926 15:40854100-40854122 GTGGGGATGGGGGATGGGGAGGG - Intronic
1125697532 15:41651751-41651773 AGGGGGAGGGGAGAGGAGGAGGG - Intronic
1126184473 15:45818614-45818636 ATGGGGCGGGGGGATGGGGAAGG - Intergenic
1126322929 15:47444986-47445008 ATGGGGAGCTGGAAGGGGGATGG + Intronic
1126567420 15:50114559-50114581 ATAGGGAAGTGAGAAGAGGAAGG - Intronic
1126876327 15:53045565-53045587 ATGAGGCGGTGGGAAGAGGAAGG - Intergenic
1127454291 15:59143347-59143369 GTGGGCAGGTGGGTGGAGGAGGG + Intronic
1127495560 15:59508383-59508405 ATGGGTAGGTGGTGTGAGAAAGG + Intronic
1128145884 15:65332296-65332318 CTGGGGAGGAGGGAAGAGGGAGG - Intronic
1128182006 15:65612362-65612384 ATTAGGAGATGGGACGAGGAAGG + Intronic
1128252239 15:66171526-66171548 ATGGAGAGGTGGGAGGAGGAGGG + Intronic
1128314297 15:66650607-66650629 ATGGGGAAGTGGGACAGGGAGGG + Intronic
1128338411 15:66803143-66803165 ATGGGGAGGCAGGGGGAGGAGGG - Intergenic
1128339509 15:66810857-66810879 ATGGGGTGGGGGGATGGGGGAGG - Intergenic
1128377900 15:67090239-67090261 CTGGGGTGGTGGGAAGAGCAGGG + Intronic
1128697149 15:69775032-69775054 GTGGGGTGGAGGGATGGGGAAGG + Intergenic
1128783360 15:70377421-70377443 GAGGGGAGGTTGGAGGAGGAAGG - Intergenic
1129045983 15:72734597-72734619 GTGGGGAGGTGGAATGGGCAGGG + Intronic
1129267694 15:74402847-74402869 GTGTGGAGGTGGGAAGAGGCAGG + Intergenic
1129306431 15:74667459-74667481 AGGGGGTGGAGGGAGGAGGAGGG + Intronic
1129332048 15:74832719-74832741 ATGGGGAGGGGGAAGGAAGAAGG - Intergenic
1129450990 15:75651357-75651379 TTGGGGAGGTGGCAGGAGGAAGG - Intronic
1129653411 15:77507294-77507316 GTGGGGAGCAGGGAAGAGGAAGG - Intergenic
1129740507 15:77987442-77987464 ATTTGGAGGTGGGATGGGGTAGG + Intronic
1130074480 15:80676874-80676896 ATGGGGCATTGGGATGAGGGAGG - Intergenic
1130109650 15:80953982-80954004 CTGGGGATTGGGGATGAGGAAGG - Intronic
1130696502 15:86136768-86136790 GTGAGGAGCTGGGAGGAGGAAGG + Intergenic
1131133092 15:89912654-89912676 GTGGGGGGGTGGGATGCGGGTGG - Intronic
1131253135 15:90844069-90844091 ATGGGAAGGAGGGAGGAGGGAGG - Intergenic
1131284807 15:91048142-91048164 AGGGGGAGGGGGGAGGGGGAGGG - Intergenic
1131499909 15:92952321-92952343 CTGGGGAGGAGGGAGGGGGATGG + Intronic
1131828826 15:96341601-96341623 ATAGGGGGATGGGAAGAGGACGG + Intergenic
1132078625 15:98845469-98845491 AGGAGGAGGAGGGAGGAGGAGGG - Intronic
1132112154 15:99109481-99109503 AAGGTGGGGTGGGATTAGGATGG + Intronic
1202986999 15_KI270727v1_random:427812-427834 ATGCTGAGCTGGGATGTGGAAGG - Intergenic
1132482098 16:171905-171927 GAGGGGATGTGGGGTGAGGAAGG - Intergenic
1132703282 16:1230992-1231014 ATGGGGAGCTGGGCTGGGGTTGG - Intergenic
1132703295 16:1231025-1231047 ATGGGGAGCTGGGCTGGGGCTGG - Intergenic
1132703332 16:1231124-1231146 ATGGGGAGCTGGGCTGGGGCTGG - Intergenic
1132703345 16:1231157-1231179 ATGGGGAGCTGGGCTGGGGCTGG - Intergenic
1132703379 16:1231257-1231279 ATGGGGAGCTGGGCTGGGGCTGG - Intergenic
1132703392 16:1231290-1231312 ATGGGGAGCTGGGCTGGGGCTGG - Intergenic
1132703419 16:1231357-1231379 ATGGGGAGCTGGGCTGGGGCTGG - Intergenic
1132703432 16:1231390-1231412 ATGGGGAGCTGGGCTGGGGCTGG - Intergenic
1132703445 16:1231423-1231445 ATGGGGAGCTGGGCTGGGGCTGG - Intergenic
1132703472 16:1231490-1231512 ATGGGGAGCTGGGCTGGGGCTGG - Intergenic
1132708058 16:1254944-1254966 ATGGGGAGCTGGGCTGGGGCTGG + Intergenic
1132708071 16:1254977-1254999 ATGGGGAGCTGGGCTGGGGCTGG + Intergenic
1132708082 16:1255009-1255031 ATGGGGAGCTGGGCTGGGGCTGG + Intergenic
1132708092 16:1255041-1255063 ATGGGGAGCTGGGCTGGGGCTGG + Intergenic
1132708105 16:1255074-1255096 ATGGGGAGCTGGGCTGGGGCTGG + Intergenic
1132708163 16:1255239-1255261 ATGGGGAGCTGGGCTGGGGCTGG + Intergenic
1132868272 16:2104349-2104371 TTGGGGGAGGGGGATGAGGATGG + Intronic
1132989798 16:2786859-2786881 ATGGGGGAGGGGGATGAGGGAGG - Intronic
1133061111 16:3175136-3175158 AGGGGGAGGTGGGCTGGGGTGGG - Intergenic
1133493901 16:6297878-6297900 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1133520202 16:6549315-6549337 GAGGGGAGGAGGGAGGAGGAGGG + Intronic
1133520260 16:6549463-6549485 GTGGGGAGGAGGGAGGAGGAGGG + Intronic
1133749384 16:8712947-8712969 ATGGGGAGGGGGTATGGGGTTGG - Exonic
1133976420 16:10602388-10602410 AGGTGGAGGTGGGAGGTGGAGGG - Intergenic
1134045267 16:11096381-11096403 CCAGGGAAGTGGGATGAGGAGGG - Intronic
1134066595 16:11232462-11232484 AGGGGCAGGGGGGAGGAGGAGGG + Intergenic
1134066606 16:11232481-11232503 AGGGGGAGGGGGGAGGAGGAGGG + Intergenic
1134066613 16:11232494-11232516 AGGAGGAGGGGGGAGGAGGAGGG + Intergenic
1134297570 16:12960772-12960794 TTGGAGAGGAGGGAAGAGGACGG - Intronic
1134419452 16:14071803-14071825 AGTGGGAGGTGGGAAGAGGAAGG - Intronic
1134523463 16:14928670-14928692 TTGGGGGAGGGGGATGAGGATGG - Intronic
1134523474 16:14928696-14928718 TTGGGGGAGCGGGATGAGGATGG - Intronic
1134711057 16:16327154-16327176 TTGGGGGAGGGGGATGAGGATGG - Intergenic
1134711068 16:16327180-16327202 TTGGGGGAGCGGGATGAGGATGG - Intergenic
1134775276 16:16847749-16847771 ATGGGGTGGGGGGATGGGGGAGG - Intergenic
1134873680 16:17676191-17676213 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1134948497 16:18341377-18341399 TTGGGGGAGGGGGATGAGGATGG + Intergenic
1134948506 16:18341403-18341425 TTGGGGGAGCGGGATGAGGATGG + Intergenic
1134948515 16:18341429-18341451 TTGGGGGAGCGGGATGAGGATGG + Intergenic
1134948526 16:18341455-18341477 TTGGGGGAGGGGGATGAGGATGG + Intergenic
1135002342 16:18787310-18787332 ATGGAAAAGAGGGATGAGGAAGG - Intronic
1135063745 16:19291952-19291974 ATGGGGAGGTGGGGTGTAAATGG + Intronic
1135164774 16:20129567-20129589 AAGGGAAGGGGGGATGGGGAGGG - Intergenic
1135166566 16:20144387-20144409 ATGGGGTGGGGGGATGGGGGAGG - Intergenic
1135587208 16:23680032-23680054 ATGGGGAGGTGGATTGAGGCCGG - Intronic
1135672511 16:24387296-24387318 ATGGGGAGTTGGAAAGGGGATGG + Intergenic
1136141955 16:28293563-28293585 ATGGAGAGGGGGGAAGAGGGCGG + Intronic
1136367417 16:29815142-29815164 ATGAGGAGGCAGGAAGAGGAAGG - Intronic
1136421615 16:30137633-30137655 TTGGGGAGGCGGGAGGAGGTTGG + Intergenic
1136541262 16:30928647-30928669 AAGGGAAGGTGGGAAGGGGAGGG - Intronic
1136736036 16:32468661-32468683 ATGGGCTGGTGGGATAGGGAAGG + Intergenic
1137335159 16:47541138-47541160 ATGTGGTGGTGTGATGGGGAAGG - Intronic
1137666675 16:50253777-50253799 GTGGTGAGGTGGGTTGAGGTGGG + Intronic
1137762061 16:50948889-50948911 AATGGGAAGTGGGATGAGGGGGG + Intergenic
1137832575 16:51558047-51558069 ATGGGGAGGGGGGAGGATGAGGG + Intergenic
1137892317 16:52175456-52175478 GTGGGGAGGTGGGAGGGGGGAGG + Intergenic
1137981324 16:53072515-53072537 ATGGTGGGGTGGGGTGAGGTGGG - Intronic
1138163899 16:54781707-54781729 ATGTGGATGTGGGAGTAGGAAGG - Intergenic
1138183782 16:54961212-54961234 GAGGGGAGATGGGATGGGGAGGG + Intergenic
1138217163 16:55214493-55214515 AAGGGGAGGAGGGGTGAGGAGGG + Intergenic
1138456584 16:57124703-57124725 ATGGGGAGGTGGGCAGAGCGTGG - Intronic
1138530017 16:57629842-57629864 CAGGGGAGGTGGGTTGGGGACGG - Intronic
1138624260 16:58236658-58236680 ATGGGGAAGGGGGTTGAGGGAGG + Intronic
1138641853 16:58393895-58393917 AGGGGGAAGTGGGAAAAGGAAGG - Intronic
1138672836 16:58629563-58629585 ACGGGGAAGTGGGACGAGGCGGG - Intronic
1138749958 16:59407994-59408016 ATGGGGTGGGGGGAGGGGGAAGG - Intergenic
1138752678 16:59443091-59443113 ATGGGGTGGGGGGAGGGGGAAGG - Intergenic
1139328051 16:66167103-66167125 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1139351744 16:66341164-66341186 AGGGGGAGATGAGATGAAGAGGG + Intergenic
1139387912 16:66586098-66586120 ATGGGCAGGAGGGTTGAGGAAGG + Intronic
1139392914 16:66616775-66616797 ATGGTGAGGAGGGGAGAGGAGGG - Exonic
1139419747 16:66843123-66843145 ATGGGGAGGTCAGGAGAGGAGGG + Intronic
1139424991 16:66873863-66873885 AGGAGGAGGAGGGAGGAGGAGGG - Intergenic
1139851018 16:69951660-69951682 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139880000 16:70174572-70174594 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139889401 16:70238966-70238988 GTGGGGAGAGGGAATGAGGAAGG + Intergenic
1139925463 16:70483289-70483311 ATGGGGAGAGGAGAGGAGGATGG - Intronic
1140063744 16:71592543-71592565 ATGGAGAGGAGGGAGGAGAAAGG - Intergenic
1140074879 16:71689317-71689339 AGGTTGAGGTGGGAGGAGGATGG - Intronic
1140092981 16:71852422-71852444 ATGGTGAGGAGAGATGGGGAAGG - Exonic
1140150057 16:72353645-72353667 ATGGGGTGGGGGGAGGGGGAGGG + Intergenic
1140176151 16:72662274-72662296 AGGGTGAGGTGGGATGGGGTTGG + Intergenic
1140266878 16:73428643-73428665 ATGGTGGGGAGGGAGGAGGAAGG - Intergenic
1140321630 16:73958061-73958083 ATGGGGTGGTGGGGAGAGGAGGG + Intergenic
1140372514 16:74420955-74420977 CTGGGGAGGAAGGAGGAGGAAGG - Intronic
1140461749 16:75145729-75145751 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1140847567 16:78904956-78904978 ATTGGGAGGTAGGATAAGGATGG - Intronic
1140943816 16:79748937-79748959 CTGGGCAGGTGTGATCAGGAAGG - Intergenic
1141369926 16:83477620-83477642 ACAGGGAGGTGGGAGGAGGAAGG + Intronic
1141372476 16:83500559-83500581 AAGAGGAGGAGGGAGGAGGAGGG - Intronic
1141635114 16:85310509-85310531 AGGAGGAGGTGGGAGGAGGGGGG - Intergenic
1141673304 16:85504187-85504209 TTGGTGAAGTGGGCTGAGGAGGG + Intergenic
1141703577 16:85653198-85653220 AGGGGGAGGGGGGAGGAGGGGGG - Intronic
1141724428 16:85777793-85777815 TTGGGGAGGTGGTAAGAGGGAGG + Intronic
1141775720 16:86121608-86121630 AGGAGGAGGAGGGAGGAGGAGGG - Intergenic
1141946104 16:87311071-87311093 AAGGGGAGATGGGAGGAAGAAGG - Intronic
1142099664 16:88264603-88264625 AGGGGGATGTGGGAGGAAGATGG - Intergenic
1142186776 16:88698446-88698468 AGGAGGAGGGTGGATGAGGAGGG + Intronic
1142196291 16:88740754-88740776 AGGGTGAGGTGGGAGGAGGCTGG + Intronic
1203017039 16_KI270728v1_random:360913-360935 ATGGGCTGGTGGGATAGGGAAGG - Intergenic
1203035374 16_KI270728v1_random:634071-634093 ATGGGCTGGTGGGATAGGGAAGG - Intergenic
1142596397 17:1031908-1031930 ATGCGGAGGAGGGAGGAGGGAGG - Intronic
1142755753 17:2015490-2015512 TTGGAGAGGTGGCAAGAGGAGGG + Intronic
1142824364 17:2498865-2498887 AGGAGGAGGTGGGCTGGGGATGG - Intronic
1143328509 17:6117455-6117477 GTGGGGAGGTGAGAGGAGGCTGG + Intronic
1143352473 17:6298821-6298843 AGGGGAAGGTGGCATGAGGATGG - Intergenic
1143381310 17:6498022-6498044 ATGGGGGCGTGGGCAGAGGAAGG + Intronic
1143476383 17:7205845-7205867 ATGGGGATGGGGATTGAGGATGG - Intronic
1143481065 17:7227620-7227642 CTGGGAGGGTGGGATGAGGTGGG + Intronic
1143548305 17:7613501-7613523 AGGGGGAGGTGAAATAAGGAAGG + Intronic
1143564012 17:7710578-7710600 ATCAGGAGGTGGGAGGTGGATGG + Exonic
1144063243 17:11601788-11601810 ATGGGGAGGTGGAAGGAAAAGGG - Intronic
1144196030 17:12896109-12896131 AGGGGGAGGGGGGAGGGGGAGGG + Intronic
1144219353 17:13086099-13086121 ACGGGGAGGGGGCAGGAGGAGGG - Intergenic
1144409943 17:14991165-14991187 AAGGGGATGTGGGATGCTGAAGG + Intergenic
1144461614 17:15463194-15463216 ATGGGGAAGTGGGTAGGGGAGGG + Intronic
1145320730 17:21765823-21765845 GTGAGGAGGTGGGCTGAGGTGGG - Intergenic
1145770873 17:27492113-27492135 GTTGGGAGGTGGGAGGAGGGAGG + Intronic
1145894461 17:28445859-28445881 GTTGAGAGGTGGGAGGAGGAGGG - Intergenic
1146006282 17:29162740-29162762 ATGGGCAGGTGGAAGGATGATGG + Intronic
1146364825 17:32214606-32214628 ATTGGGTGGTGGGATGAGAATGG + Intronic
1146379056 17:32315008-32315030 ATGGGGAGAAGGGAGGAGGTGGG + Intronic
1146465603 17:33083890-33083912 CTGAGGATGTGGGTTGAGGAAGG + Intronic
1147459547 17:40559479-40559501 TGAGGGAGGTGGGCTGAGGAAGG + Intronic
1147498826 17:40942615-40942637 AAGAGGAGGGGGGAGGAGGAAGG - Intergenic
1147623066 17:41880992-41881014 ATGGGGAGGTGGGGTGGAAAGGG + Intronic
1147951125 17:44108619-44108641 ATGGGGAGAGGGGGTGGGGAGGG + Intronic
1148044002 17:44731257-44731279 GTGGGGATGTGGGATGTGGCGGG + Intronic
1148149505 17:45388361-45388383 ATGAGGACGCGGGATGGGGAAGG + Intergenic
1148199734 17:45742026-45742048 ACGGGGAGATGGGAGAAGGAGGG + Intergenic
1148432124 17:47650552-47650574 AGGGGGAGGGGGGAGGGGGACGG - Intronic
1148486114 17:47991761-47991783 AGGGGGAGGGGCGAGGAGGAGGG + Intergenic
1148493509 17:48037926-48037948 AAGGAGAGGTGGGGTGAGGGCGG - Intronic
1148537768 17:48455162-48455184 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1148682855 17:49484635-49484657 AAGGGGAGGAGGGGTGGGGAGGG - Intergenic
1148777256 17:50102566-50102588 AGGGGCAGGTGGGGAGAGGAGGG - Intronic
1148902330 17:50887766-50887788 ATGGAGAGTTGGGAGGAGGAAGG + Intergenic
1149291812 17:55225061-55225083 CTGGGAAGGTGGTATGTGGATGG - Intergenic
1149420487 17:56506204-56506226 ATGGGGTGGTGGGAGGGGGGAGG - Intronic
1149429335 17:56584834-56584856 ATGGGAGGTGGGGATGAGGATGG + Intergenic
1149431414 17:56597442-56597464 GTGGGGAGTGGGGAAGAGGAGGG + Intergenic
1149866134 17:60151994-60152016 AGGGGGAGGTGGGGTGAGCAAGG + Intronic
1150118560 17:62578232-62578254 ATGGAGAGGAGGGAGGAGGAGGG + Intronic
1150146437 17:62773507-62773529 AGGGGGATGTGGGATAAGGAAGG + Intronic
1150209766 17:63435628-63435650 CCAGGGAGGTGGGAGGAGGAGGG - Intronic
1150339397 17:64354384-64354406 AGGGGAAGATGGGGTGAGGAGGG - Intronic
1150433847 17:65139246-65139268 ATGGGGAGCTGGGATGCAGGAGG - Intronic
1150455158 17:65301304-65301326 ATGGGGAAGTGGCATCGGGAGGG + Intergenic
1150505747 17:65696926-65696948 GTGGGGAGGAGGGATGCGGGAGG + Intronic
1150510949 17:65752539-65752561 CTGGAGAGGTGGAATGAGAAAGG - Intronic
1150623892 17:66829197-66829219 TTGGGGAGGTGGCATGAGCCTGG + Intergenic
1150861276 17:68803103-68803125 ATGGTGTGGTGGGAAAAGGAGGG + Intergenic
1150868099 17:68875866-68875888 TAGGGCAGGTAGGATGAGGAAGG + Intronic
1150931524 17:69590241-69590263 ATGGGGAGCTGGGAAGGGGATGG + Intergenic
1150936762 17:69644064-69644086 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1150998662 17:70348791-70348813 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1151239107 17:72744025-72744047 ATGGGGAGGTGGAGAGAGGCAGG - Intronic
1151347906 17:73514552-73514574 ATGGGTCGGTGGGTGGAGGAAGG + Intronic
1151642198 17:75404543-75404565 AGGGGGGGGTGGGGGGAGGAAGG + Intronic
1151657939 17:75504330-75504352 ATGGAAAGGTGGCAGGAGGAAGG + Intronic
1151834360 17:76573376-76573398 ATGGGGAGCAGCCATGAGGAGGG + Intronic
1151885157 17:76919200-76919222 ATGGGGAGATGGGATGAGGGAGG - Intronic
1152000082 17:77639908-77639930 AAGAGGAGGAGGGAGGAGGAGGG - Intergenic
1152035823 17:77871986-77872008 ATGGGGTGGGGGAAGGAGGAAGG + Intergenic
1152043049 17:77917433-77917455 AGGAGGAGGAGGGAGGAGGAGGG + Intergenic
1152099457 17:78292520-78292542 ATGGAGAGGGCAGATGAGGAGGG - Intergenic
1152179010 17:78806229-78806251 ATGGTGAGGGGGGAGGTGGACGG + Exonic
1152238377 17:79149958-79149980 ATGGGGATGGGGGCTGAGGGTGG + Intronic
1152238404 17:79150008-79150030 ATGGGGATGGGGGTTGAGGGTGG + Intronic
1152238426 17:79150047-79150069 ATGGGGATGGGGGTTGAGGGTGG + Intronic
1152315945 17:79580260-79580282 ATGGGGGGGGAGGAGGAGGACGG - Intergenic
1152368320 17:79870220-79870242 GAGGGGAAGTGGGAGGAGGAAGG - Intergenic
1152377963 17:79928394-79928416 ATGGGGAAGTGGGAGTGGGAGGG + Intergenic
1152410501 17:80120421-80120443 AAGGGGAGGTGACATGGGGAGGG - Intergenic
1152410531 17:80120484-80120506 AAGGGGAGGTCAGGTGAGGAGGG - Intergenic
1152659333 17:81535224-81535246 ATGGGGATGATGGAGGAGGAAGG - Intronic
1152659961 17:81537522-81537544 CTGGGGAGGTGGGACCAGCACGG + Intergenic
1152859083 17:82685215-82685237 ATGGGGAGGGGGAGGGAGGACGG + Intronic
1153104037 18:1507415-1507437 ATGGGAGGGAGGGATAAGGAGGG - Intergenic
1153681457 18:7504823-7504845 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1155066506 18:22273693-22273715 AGGAGGAGGAGGGAGGAGGAGGG - Intergenic
1155066543 18:22273781-22273803 AGGAGGAGGAGGGAGGAGGATGG - Intergenic
1155066557 18:22273824-22273846 AGGGGGAGGAGGGAGGAGGAGGG - Intergenic
1155066589 18:22273915-22273937 AAGAGGAGGAGGGAGGAGGAGGG - Intergenic
1155351184 18:24908017-24908039 AAGGGGAGCTGAGATGAAGAAGG - Intergenic
1155394907 18:25376959-25376981 ATGAGGAGCTGGGAAGGGGATGG - Intergenic
1155492255 18:26410671-26410693 CTGGGGAGGTGGTAGGGGGAGGG + Intergenic
1155683705 18:28520914-28520936 ATGGGGAGCTGGAAAGAGGATGG - Intergenic
1155735844 18:29221217-29221239 GTGGGGTGGGGGGATGGGGAAGG + Intergenic
1155767941 18:29659166-29659188 ATGGGGGTGGGGGATGGGGATGG + Intergenic
1156076787 18:33288378-33288400 AAGGGGAGGGGGGGAGAGGAGGG - Intronic
1156256628 18:35404139-35404161 ATGGGGTGGAGGGATGGGGGAGG - Intergenic
1156316102 18:35970547-35970569 ATGGAAAGGTGGGAAGAGCAGGG + Intergenic
1156933907 18:42679337-42679359 ATGGTGAGGTGGCAAGAGTATGG - Intergenic
1156978587 18:43257700-43257722 ATGGGGAGATCTGATGAGGTAGG - Intergenic
1157257261 18:46150379-46150401 ATGTGGAGGTGGGAGGAGGCTGG - Intergenic
1157447281 18:47755040-47755062 AGGCTGGGGTGGGATGAGGATGG + Intergenic
1157777833 18:50410153-50410175 ATGGGCAGGTGGGAGGAGCCTGG - Intergenic
1157874190 18:51256640-51256662 ATGTGGTGGTGGGGGGAGGAGGG + Intergenic
1157914857 18:51654946-51654968 ATGGGGAGGCGGAGTGGGGAAGG - Intergenic
1158543224 18:58375135-58375157 ACGGGGAGATGGCATGAGGAGGG - Intronic
1158753746 18:60297961-60297983 ATGAGGAGGTGGGAAGATAAAGG + Intergenic
1158841974 18:61397245-61397267 ATGGGGAGGTTGGGTGACGATGG - Intronic
1158911149 18:62063927-62063949 ATGGGGTGGGGGGAGGGGGAAGG + Intronic
1158968542 18:62644671-62644693 AAGGGGAGCTGGAAAGAGGATGG - Intergenic
1159330456 18:66987523-66987545 CTGGGGAGGTGGGTTAAGGAAGG - Intergenic
1159610146 18:70515791-70515813 ATGGGGTGGGGGGAGGGGGAGGG - Intergenic
1159726578 18:71967858-71967880 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1159887768 18:73925273-73925295 ATGGGAAGGTGGGACAAGCATGG + Intergenic
1159923355 18:74246617-74246639 ATGGGGAGGTGGGAAGACAATGG - Intergenic
1159923387 18:74246717-74246739 ATGGGGAGATAGCAGGAGGATGG - Intergenic
1160102410 18:75935350-75935372 ATGGAGAAGTGAGATCAGGAGGG + Intergenic
1160127468 18:76189597-76189619 ATGGGGAGATGGAAAGTGGATGG - Intergenic
1160238799 18:77107417-77107439 ATAAGGAGGTGGGAGGAGGAGGG - Intronic
1160433372 18:78827632-78827654 CTGGGGAGGTGGAATGGGGGTGG - Intergenic
1160703229 19:518044-518066 AGGGGGTGCTGGGAGGAGGAAGG + Intronic
1160848988 19:1180670-1180692 CTGGGGAAGTGGGTGGAGGAAGG - Intronic
1160882947 19:1330656-1330678 TGGGGGAGGTGGGCTGAGGTTGG + Intergenic
1160900250 19:1424350-1424372 AGGGGGAGGGGGGAGGGGGAGGG - Intronic
1161012694 19:1968080-1968102 CTGGGGAGGAGGGAGGAGGGAGG - Intronic
1161012730 19:1968188-1968210 CTGGGGAGGAGGGAGGAGGGAGG - Intronic
1161012789 19:1968358-1968380 CTGGGGAGGAGGGAGGAGGGAGG - Intronic
1161258362 19:3322108-3322130 ATGGGGACATGGAAGGAGGAGGG + Intergenic
1161633083 19:5369184-5369206 ATGGGGAGGGGTGATGACCAAGG - Intergenic
1161978663 19:7619557-7619579 GTGGGGAGGGGGGATGGGGGAGG + Exonic
1162018068 19:7856352-7856374 ACGGGGAGGGGTGAGGAGGAGGG + Intronic
1162273851 19:9637713-9637735 ATGGTGATGTAGGATGTGGAAGG + Intronic
1162450800 19:10753379-10753401 AGGGGGAGGGGGGAAGGGGAAGG - Intronic
1162799106 19:13101274-13101296 ATGGGAAGGAGGGAGGGGGAGGG + Intronic
1163018542 19:14471054-14471076 GTGGAGATGTGGGATTAGGAGGG - Intronic
1163035770 19:14567974-14567996 CTGGGGAGGAGGGATGTGGGAGG - Intronic
1163137647 19:15324202-15324224 CTGGGGAGGGGGGAAGGGGAAGG + Intronic
1163153019 19:15425806-15425828 AGGAGGAGGAGGGAGGAGGAGGG + Intronic
1163174857 19:15557128-15557150 ATGGAGAAGAGGGATGGGGAAGG - Intergenic
1163321468 19:16577285-16577307 GTGGGGAGGGGGGATGAGTTGGG + Exonic
1163530752 19:17847650-17847672 GTGGGGAGGAGGGATTGGGAAGG - Intronic
1163629884 19:18412903-18412925 AAGGGCAGGTGGGATCAGGTGGG + Intergenic
1163827871 19:19533630-19533652 AAGAGGAGGAGGGGTGAGGAGGG - Intronic
1163869273 19:19804932-19804954 ATGGGGTGGGGGGATGGGGGAGG + Intronic
1164091598 19:21957977-21957999 ATGGGGTGGTGGGAAGGGGGAGG - Intronic
1164441369 19:28282847-28282869 AGGGGGAGGTGGGGAGAAGATGG - Intergenic
1164499817 19:28808632-28808654 ATGGGGTGGGGGGAGGAGGGAGG + Intergenic
1164591879 19:29511931-29511953 AAGGAGAGGGAGGATGAGGAAGG + Intergenic
1164688106 19:30184799-30184821 ATGGGGTGGGGGGAGGGGGAAGG - Intergenic
1165098237 19:33422054-33422076 AGGGGGAGGTGGGCTGCCGATGG - Intronic
1165458166 19:35927022-35927044 ATGGGGAGATGATACGAGGATGG + Intergenic
1165726293 19:38115306-38115328 ATGGGAAGGTGGGAGGAGAGAGG - Intronic
1165893401 19:39127833-39127855 ATGGGGAGGAGGGCTGGGAATGG + Intronic
1165971308 19:39633123-39633145 ATGGGGTGGAGGGATGGGGGAGG - Intergenic
1166043404 19:40216115-40216137 ATGGTGAGGTGGGAGGGCGAGGG + Exonic
1166168472 19:41009443-41009465 ATGGAGAGGTGAGAAGAGGGAGG + Intronic
1166299748 19:41906988-41907010 AAGGGGAGGTGGGGAGAGGCAGG - Intronic
1166316615 19:41993131-41993153 GGGGGTAGGTGGGATGAAGAGGG - Intronic
1166328396 19:42065188-42065210 ATGGGGGCGTGGGGTGAGGCAGG - Intronic
1166561793 19:43737551-43737573 GTGGGGAGGAGGAATGAGGCAGG - Intronic
1166737904 19:45097052-45097074 ATGGGGCTGTGGGAGGTGGAGGG + Intronic
1166888118 19:45973586-45973608 GAGGGGAGGTGGGAGGGGGAGGG + Intergenic
1166894315 19:46014670-46014692 CTGGCGAGGTGGGAGGAGGAGGG + Intronic
1166939333 19:46353360-46353382 AGGGGGAGGAGAGATGAGGCAGG - Intronic
1167080508 19:47274022-47274044 ATGGGGAGGGGGCGTGAGGAGGG + Intergenic
1167178084 19:47879778-47879800 ATGGGGCGGGGGGAGGGGGAGGG + Intronic
1167307356 19:48716755-48716777 GGAGGGAGGTGGGAGGAGGAAGG + Intronic
1167435164 19:49474859-49474881 ATGGGGAGATGGACAGAGGAGGG + Intronic
1167772717 19:51530971-51530993 ATGGGGACGCAGGATCAGGATGG + Intronic
1167889498 19:52528161-52528183 GTAGGGAGGTGGGAGGAGGGGGG - Intronic
1168251586 19:55145353-55145375 AGGAGGAGGAGGGAGGAGGAGGG + Intronic
1168423407 19:56219919-56219941 ATGGGGAGGAAGGAAGAGGAGGG + Exonic
1168467445 19:56614883-56614905 CTGGGGATGGGGGTTGAGGAAGG - Intronic
1168517112 19:57017662-57017684 AGGGAGATGGGGGATGAGGAGGG - Intergenic
1168517152 19:57017763-57017785 AGGGAGATGGGGGATGAGGAGGG - Intergenic
1168539242 19:57196773-57196795 CTGGGGAAGAGGGATGTGGATGG - Intronic
1168647106 19:58066660-58066682 GTGGTGAGATGGGAAGAGGAAGG - Intronic
1202645244 1_KI270706v1_random:133234-133256 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1202703799 1_KI270713v1_random:6072-6094 AGGGGAAGGTGGGATGAGACTGG - Intergenic
925377539 2:3398961-3398983 CAGGGGAGGTGGGAGGGGGAGGG - Intronic
925658846 2:6181321-6181343 ATGGGGAGGAGGGAGGAAGACGG - Intergenic
925726527 2:6877995-6878017 TTGGGGTGGTGGGCAGAGGAGGG - Exonic
925812863 2:7718361-7718383 GTGGGGTGGTGGGAGGGGGAGGG - Intergenic
925885378 2:8390642-8390664 ATGGGGTGATGGGATGGGGTAGG + Intergenic
925886184 2:8395239-8395261 AAGGGGAGTTGGAAAGAGGAGGG - Intergenic
926191829 2:10734227-10734249 AGGGGCAGATGGGAGGAGGAGGG - Intronic
926215161 2:10901808-10901830 GTGGGGAAGGGGGATGATGAGGG + Intergenic
926256324 2:11204248-11204270 ATTGGGAGGTGGGGAGAGGTTGG - Intronic
926335949 2:11862960-11862982 GTCGGGGGGTGGGATTAGGACGG + Intergenic
926683567 2:15681118-15681140 AGGGGGAGGGGGGAGGGGGAGGG + Intergenic
926683595 2:15681160-15681182 AGGGGGAGGGGGGAGGGGGAGGG + Intergenic
926693822 2:15756424-15756446 ATGGGTGGGTGGGATGGGGTGGG - Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
927083163 2:19650242-19650264 GTGGGGAGGAGGGATGGAGAAGG + Intergenic
927195417 2:20543092-20543114 ATGGGCAGGTGGGCAGAGGTAGG + Intergenic
927445372 2:23156338-23156360 ATGGGGAGGAGGGATAGGGATGG - Intergenic
927513330 2:23658124-23658146 ATGGGGAGGAGGGTAGAGGAAGG - Intronic
927606632 2:24491731-24491753 TCGGGGAAGTGGGAGGAGGATGG - Intergenic
927717980 2:25364719-25364741 ATGGGCAGGTGAGCTGAGGGTGG + Intergenic
927852755 2:26510512-26510534 ACGGGGGTGAGGGATGAGGAGGG - Intronic
927868661 2:26609374-26609396 AGAGGGAGGTGGGGAGAGGAGGG - Intronic
927871712 2:26628291-26628313 ATTGGGAGGTGGGGGGAGCAGGG + Intronic
927936256 2:27078511-27078533 TTGGAGAGGTGGGGGGAGGAAGG + Intergenic
928664492 2:33537119-33537141 ATGGGGAGCTGGAAAGGGGATGG + Intronic
928718762 2:34095067-34095089 ATGGGGTGGGGGGAGGGGGAGGG - Intergenic
928867749 2:35937726-35937748 ATGGGAAGGTGGGGATAGGAAGG - Intergenic
928869662 2:35961502-35961524 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
929073212 2:38055348-38055370 TTGGGGAGGTAGGTTGAGGCAGG - Intronic
929090298 2:38209963-38209985 ATGGGGTGGGGGGCTGGGGAGGG + Intergenic
929379272 2:41331168-41331190 AAGGGGAGGTGGTAGGAGAAAGG - Intergenic
929444462 2:41991845-41991867 AGGGGAAGGAGGGAGGAGGAGGG + Intergenic
929444486 2:41991914-41991936 AAGGGGAGGGGAGAGGAGGAGGG + Intergenic
929814603 2:45220963-45220985 TAGGGGAGGTGCCATGAGGAGGG - Intergenic
929857948 2:45651637-45651659 ATGGGGCGGTGGGACGGGGCGGG - Intronic
929904765 2:46036217-46036239 AGGGGAAAGTGGGATGAGGTGGG + Intronic
930050855 2:47215302-47215324 ATGGGGATGAAGGATGGGGAGGG + Intergenic
930088998 2:47518337-47518359 GTTGGGAGGTGGGAAGAGGAAGG + Exonic
930442659 2:51428521-51428543 GTGGGGTGGGGGGATGGGGAGGG + Intergenic
930852508 2:55975615-55975637 TGGGGGGGGTGGGAAGAGGAGGG + Intergenic
931093512 2:58913558-58913580 ATGGGGTGGAGGGAGAAGGAGGG - Intergenic
931198480 2:60075033-60075055 ATGGGGAGGTGAGATGGGGGAGG - Intergenic
931254412 2:60557268-60557290 AGGGGGAGGAGGGAAGGGGAGGG - Intergenic
931491137 2:62749126-62749148 GTGGGGTGGGGGGATGGGGAAGG - Intronic
931800450 2:65753122-65753144 ATGGGGTGGGGGGAGGAGGGAGG - Intergenic
931926052 2:67073734-67073756 TTGGGCAGGTGGAAGGAGGAAGG - Intergenic
932133051 2:69204767-69204789 ACTGGGAGGTGGGAAGAGGTAGG - Intronic
932577982 2:72973108-72973130 ATGGGGAGGTGGAATAAACAGGG + Intronic
932797776 2:74712410-74712432 ATGGGGACATGGGAAGAGGGTGG + Intergenic
932827269 2:74953025-74953047 ATGGGGAGTTGGAAAGGGGATGG + Intergenic
933070103 2:77846229-77846251 ATGGGGTGGGGGGAGGGGGAAGG + Intergenic
933253029 2:80050018-80050040 TTGGGGTGGTGGGAAGAGGAAGG - Intronic
933425949 2:82112540-82112562 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
933429436 2:82156777-82156799 ATGGGGAGCAGGGATGGGGTGGG - Intergenic
933785522 2:85838202-85838224 ACAGGGAGGAGGGATGGGGATGG + Intergenic
933987584 2:87604687-87604709 AGGGGGAGGTGGGGAAAGGAGGG - Intergenic
934187200 2:89757773-89757795 ATGGGCTGGTGGGATAGGGAAGG + Intergenic
934507649 2:94906820-94906842 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
934590014 2:95540230-95540252 GTTGGGAGTGGGGATGAGGATGG + Intergenic
934736981 2:96694468-96694490 CTGGCGATGTGGGATGGGGACGG + Intergenic
934791760 2:97068090-97068112 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
934891845 2:98077634-98077656 ATGGGGTGGGGGGAGGGGGAGGG + Intergenic
934969225 2:98749531-98749553 ATTGGGAGGTGGGAGAAGGGGGG + Intergenic
934969363 2:98750589-98750611 ATAGGGAGTTGGAAAGAGGATGG - Intergenic
935206485 2:100901097-100901119 ATGGGGAGGTAGAAGGAGGGAGG - Intronic
935308441 2:101759724-101759746 AGGGGGAGGGGGGAAGGGGATGG - Intronic
935358238 2:102224927-102224949 ATGGTGGGGTGGGCAGAGGAGGG - Intronic
935735726 2:106105383-106105405 ATGCGGAGGTGGCAGGAGGAGGG + Intronic
935901130 2:107794998-107795020 GTGGGATAGTGGGATGAGGAGGG + Intergenic
935958172 2:108399242-108399264 ATGGGGAGGTAGCAAGGGGATGG - Intergenic
936306256 2:111346121-111346143 AGGGGGAGGTGGGGAAAGGAGGG + Intergenic
936479180 2:112869208-112869230 ATGGATAGGTGGGATGTTGAGGG - Intergenic
936482401 2:112896793-112896815 AGGGAGAGGTGGGGTGAGGTGGG + Intergenic
936509431 2:113133195-113133217 ATGGGAAGGTGGAATGAGGGAGG - Exonic
936527503 2:113251456-113251478 GTGGGGAGGTGGGGTGGGTATGG + Intronic
936609015 2:113983329-113983351 GTGGGGAGGTGTGATGAGCCTGG + Intergenic
936927475 2:117751971-117751993 GTGGGGAGGGGGGAGGGGGAAGG + Intergenic
937010251 2:118556377-118556399 GTGGGGAGGTGAGAGGAGAAAGG + Intergenic
937526847 2:122781805-122781827 GTGGGGAGGAGGGTTGAGGGAGG - Intergenic
937676131 2:124593277-124593299 GTGGGGAGGTGGGAGGGGGGAGG - Intronic
937993628 2:127677590-127677612 AAGGGGAGGTGGCAGGTGGAGGG + Intronic
938026830 2:127956553-127956575 ATGGGGTGGGGGGAGGGGGAGGG + Intronic
938272760 2:129989655-129989677 ATGGGGTGGGGGGATGGGGGAGG + Intergenic
938443475 2:131356463-131356485 ATGGGGTGGGGGGATGGGGGAGG - Intergenic
938751871 2:134339616-134339638 AAGGGGAGTTGGGATTAGCATGG + Intronic
939056111 2:137366240-137366262 ATGGGGTGGGGGGATGAGGATGG + Intronic
939416671 2:141907979-141908001 ATGGTGAGCTTAGATGAGGAAGG + Intronic
939758914 2:146150601-146150623 GTGGGGTGGTGGGAGGGGGAGGG - Intergenic
939763296 2:146211637-146211659 ATGGGGTGGGGGGATGAGGGAGG + Intergenic
939934526 2:148274370-148274392 ATGGGGTGGGGGGCTGGGGAGGG - Intronic
940002277 2:148978177-148978199 AAGGGGAGGTGGGGAGAGGTGGG + Intronic
940120685 2:150261288-150261310 GTAGGGAAGTGGGATGGGGAGGG + Intergenic
940450968 2:153836649-153836671 GTGGGGAGGGGGGAGGGGGAGGG - Intergenic
940451357 2:153842126-153842148 ATGGGGAGGTGGGGGGAGCTGGG + Intergenic
940472005 2:154112496-154112518 TTGGGGAAGAGGGATGTGGATGG - Intronic
940658698 2:156520057-156520079 ATGGGGAGCTGGAAAGGGGATGG + Intronic
940852216 2:158699179-158699201 AGGGGGAGGAGGGAGGAGGGAGG + Intergenic
940859991 2:158761534-158761556 CTGGGGAGCTGGGATGGGGAGGG + Intergenic
940939140 2:159537571-159537593 ATGGGCAGGAGGGAAGAAGAAGG - Intronic
941038216 2:160590564-160590586 AAGGGGAAGGGGGAAGAGGAAGG - Intergenic
941067455 2:160919430-160919452 ATGGGGAGGGGCCCTGAGGATGG - Intergenic
941518920 2:166513326-166513348 ATGGAGAGGTGGGGTTTGGAAGG - Intergenic
941717529 2:168779713-168779735 ATGGGGAGTTGGAAAGGGGATGG - Intergenic
941880578 2:170476487-170476509 ATGGAGAGCTGGAATGGGGATGG + Intronic
942044903 2:172094663-172094685 TTGGGAAGGTGGGACGTGGAAGG + Intergenic
942080066 2:172391831-172391853 ATGAGGAGGTGTCATGAAGAAGG + Intergenic
942116187 2:172731365-172731387 ATGGTGGTCTGGGATGAGGAAGG + Intergenic
942468898 2:176239107-176239129 TTGATGAGGTGGGATGAGGTGGG - Intergenic
942601910 2:177650098-177650120 ATGGGGGAGTGGGAGGAGGGAGG - Intronic
943012827 2:182472554-182472576 AAGGGTATGAGGGATGAGGAGGG + Intronic
943916100 2:193634142-193634164 ATGGGGAGGGGGGAGGCGGGAGG + Intergenic
944024146 2:195143389-195143411 ATGGGGAGTTGGAAAGGGGATGG + Intergenic
944058688 2:195548699-195548721 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
944219817 2:197291815-197291837 GTGGGGTGGTGGGATGGGGGAGG - Intronic
944358702 2:198825251-198825273 ATAGGCAGGTGGGAGGGGGATGG - Intergenic
944666380 2:201962738-201962760 ATGGGGAGGTGGGGATGGGAAGG + Intergenic
944697732 2:202217991-202218013 ATGGGGAGGGGGGGAGGGGAGGG + Intronic
945047979 2:205798692-205798714 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
945343005 2:208680493-208680515 ATGGGGTGGGGGGAGGGGGAGGG - Intronic
945350017 2:208766131-208766153 ATGGGGTGGGGGGAGGGGGAGGG + Intronic
945809084 2:214526378-214526400 ATGGGGAGGTGTGAGCAGGGAGG - Intronic
946302577 2:218832801-218832823 ATGGGGAGGGTGGAGGAGAATGG + Intergenic
946401608 2:219471520-219471542 ATGCAGAGGTGGGAAGACGAGGG + Intronic
946411387 2:219516935-219516957 AGGAGGAGGTGGGATATGGAGGG + Intronic
946428689 2:219613415-219613437 AGGGGGAGGTGGGGTGAGTGAGG + Intronic
946450193 2:219773073-219773095 AAGGGGAGGTGGGAGGGAGAGGG + Intergenic
946609397 2:221441440-221441462 ATGGGGAGCTGGAAAGGGGAAGG - Intronic
946768991 2:223068751-223068773 CTGGGGGTGTGGGAAGAGGAAGG - Intronic
946779180 2:223175568-223175590 ATGGGCAGCTGGGGAGAGGAGGG - Intronic
946925510 2:224622835-224622857 ATGGGGTGGGGGGAGGGGGAGGG + Intergenic
947129167 2:226903988-226904010 ATGGGGAGGTGGAAGAAGGATGG - Intronic
947155652 2:227160548-227160570 ATGGGGAGGTGGGAATGGGGTGG - Intronic
947313363 2:228828436-228828458 AGGAGCAGGTGGGATGGGGATGG + Intergenic
947401132 2:229732558-229732580 ATGGGGAACTGGAAAGAGGATGG - Intergenic
947616740 2:231562524-231562546 ATGGGGAGGTGGGAGTAGAGAGG + Intergenic
947661207 2:231869980-231870002 GTGGGGAGGAGGGAAAAGGAAGG - Intergenic
947694852 2:232176947-232176969 GTGGGGAGGTGGGAGGGGGGAGG - Intronic
947701853 2:232241011-232241033 GTGGGGAGCTGGGTGGAGGAAGG + Intronic
947760947 2:232603418-232603440 AGGAGGAGGTGGAAGGAGGAAGG + Intergenic
947817458 2:233047798-233047820 AGGAGGAGGCGGGAGGAGGATGG + Intergenic
947891154 2:233621872-233621894 ATGGGGTGGGGGGCTGAGGAAGG - Intronic
948008258 2:234629063-234629085 ATGGGGAGCTGGGAGGGGGATGG - Intergenic
948091926 2:235302165-235302187 AAGGGGAGGAGGGAGGAGGAGGG - Intergenic
948091938 2:235302199-235302221 AGGGGGGAGGGGGATGAGGAGGG - Intergenic
948248570 2:236507010-236507032 ATGGGGTGGTGGGACGCGTAGGG + Intronic
948326824 2:237128426-237128448 ATGGGGTGGCGGGAGGGGGAGGG + Intergenic
948538964 2:238672210-238672232 AGGAGGAGGGGGGAGGAGGAGGG - Intergenic
948566787 2:238892277-238892299 ATGCGGAGGCGGCACGAGGAGGG + Intronic
948722302 2:239908783-239908805 ATGGGAAGGTGGGCTGTGGAGGG - Intronic
948733139 2:239979886-239979908 ATGGTGAGGTGTGATGCGGGTGG - Intronic
948924887 2:241089057-241089079 GTGGGGAGGTGGGGGCAGGATGG - Exonic
949043263 2:241858999-241859021 TGGGGGAGGAGGGGTGAGGAGGG + Intergenic
949062594 2:241969842-241969864 ATGGGGTGTGGGGATGATGACGG + Intergenic
1168770076 20:408888-408910 ATGGGGAGGAGGGTAGAGGGAGG - Intronic
1168904089 20:1390345-1390367 ATGGGGAGGGGGGAGGGGGGAGG + Intronic
1168924315 20:1566747-1566769 GTGGGCAGGTGGTGTGAGGATGG + Intronic
1169038088 20:2470199-2470221 ATGGAGAGGAGGGCGGAGGAGGG - Intronic
1169064401 20:2686182-2686204 CTGGGGAGGTAGGAGGAGGGTGG - Intergenic
1169091735 20:2865100-2865122 ATGGGGATGAGGGACCAGGAGGG - Intronic
1169178619 20:3542548-3542570 AAGGGGAGGTGGAAGGGGGAAGG - Intronic
1169284872 20:4299544-4299566 ATGTGGTGGTGGGCTGAGGGAGG + Intergenic
1169554743 20:6737232-6737254 ATGGAGATGTGGGAGGAAGAAGG + Intergenic
1169850034 20:10037992-10038014 ATGGTAAAGTGTGATGAGGAGGG + Intronic
1170081438 20:12480963-12480985 ATGGGGTGGTGGGAGGGGGGAGG + Intergenic
1170235724 20:14102783-14102805 ATGGGGATATAGGATGGGGATGG + Intronic
1170335007 20:15260267-15260289 GTGGGGAGGGGGGATAAAGAGGG - Intronic
1170559439 20:17544116-17544138 GTGGGGAAGTGAGATGGGGAAGG + Intronic
1170665743 20:18384660-18384682 TTGGGGAGGTGGGACCAGGAGGG - Intronic
1170766972 20:19298567-19298589 ATGGGGAAGTGAGACCAGGAAGG + Intronic
1171079347 20:22162485-22162507 TTGAGGAGTTGGGATCAGGAGGG + Intergenic
1171209314 20:23304718-23304740 TTGGGGAGGTGGGATGCTGTCGG - Intergenic
1171211566 20:23321011-23321033 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1171384796 20:24763038-24763060 AGGGGAAGGTGGGCTGGGGAAGG + Intergenic
1171422841 20:25030425-25030447 GTGTGGAGGTGGGATAAGGCTGG - Intronic
1171895207 20:30752154-30752176 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1171903107 20:30875236-30875258 GTGGGGTGGTGGGAGGGGGAAGG - Intergenic
1172051821 20:32123192-32123214 AGGGGGAGGGGGGAGGGGGAGGG + Intronic
1172072805 20:32270875-32270897 TTGGGGAGGAGGGCTGAAGAGGG - Intergenic
1172247732 20:33457421-33457443 GTGGGAAGGTGGGAATAGGATGG + Intergenic
1172617292 20:36297842-36297864 AGGGGGAGGCCGGAAGAGGATGG - Intergenic
1172638036 20:36423065-36423087 ATGGGGGGCTTGAATGAGGACGG - Intronic
1172696446 20:36826341-36826363 AGGGGGAGGGGGGAGGGGGAGGG - Intronic
1172950476 20:38720218-38720240 ATGAGGAGTTTGGATTAGGAAGG - Intergenic
1172980116 20:38935119-38935141 ATGGGGAGGAGGGACAAGGATGG + Intronic
1173040356 20:39456321-39456343 AGGGGAAGCAGGGATGAGGATGG - Intergenic
1173268125 20:41505530-41505552 ATCCGGAGGTGGGCTGACGATGG - Intronic
1173369928 20:42426417-42426439 ATGGGGAGGTGGAAAGGGGATGG - Intronic
1173465956 20:43281620-43281642 GAGGGGAAGTGGGATGGGGAAGG - Intergenic
1173478453 20:43380373-43380395 ATATGGAGGTGAGATGGGGATGG - Intergenic
1173624537 20:44462761-44462783 ATGGGGTGGTGGGATGAATGGGG - Intronic
1173885762 20:46457636-46457658 ATGGCGAGCTGGACTGAGGATGG - Intergenic
1173997152 20:47347026-47347048 ATGGGGAGGGAGGAAGAGGCTGG - Intronic
1174138624 20:48397826-48397848 AGGAGGAGGTGAGAGGAGGAAGG - Intergenic
1174323255 20:49759101-49759123 ATGTGGAGGTGGGGTGAGAATGG - Intergenic
1174379673 20:50148540-50148562 ATGGGGAGCTAGGAAGAGCAGGG + Intronic
1174521279 20:51132614-51132636 AGGGGGAGGAGGGAAGAGGCAGG - Intergenic
1174761417 20:53210409-53210431 ATGAGGAGTTGGGAGGGGGATGG + Intronic
1175356848 20:58375407-58375429 ATGGGGGAGGGGGAGGAGGAGGG - Intergenic
1175409372 20:58756048-58756070 ATGGGGAGGGGGCATCATGAAGG - Intergenic
1175657774 20:60786927-60786949 AAGGGGAGGAGGAAGGAGGAGGG - Intergenic
1175770843 20:61623148-61623170 ATGTGGAGGTGGGAGTAGAAGGG + Intronic
1175785010 20:61706824-61706846 ATGTGGAGGTCGGATGCTGACGG - Intronic
1175989138 20:62778871-62778893 ATGGGGAGAGGAGCTGAGGATGG + Intergenic
1175998635 20:62822224-62822246 CTGGGGAGGGGGAATGGGGAGGG - Intronic
1176057181 20:63154945-63154967 GTGGGGAGGAGGGAGGAGGGAGG - Intergenic
1176097065 20:63349146-63349168 ATGGGCTGGTGGCAGGAGGACGG - Intronic
1176122192 20:63458892-63458914 CTGGGGGGCTGAGATGAGGAGGG + Intronic
1176311719 21:5154275-5154297 ATGAGGAGGTGGGACGGGGCGGG - Intronic
1176736726 21:10556184-10556206 ATGGGGTGGGGGGATGGGGGAGG - Intronic
1176966863 21:15220937-15220959 ATGGGGAGGTGGGGAAAGAAAGG - Intergenic
1176981525 21:15386790-15386812 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1177143420 21:17381904-17381926 GTGGGGAGGGGGGAGGGGGAGGG + Intergenic
1177192684 21:17869342-17869364 AGGAGCAGGTGGGATGGGGATGG + Intergenic
1177584865 21:23078023-23078045 ATTGGGAGGGGAGATGAAGATGG + Intergenic
1177849345 21:26328155-26328177 ATGGGGTGGGGGGATGGGGGAGG - Intergenic
1178005962 21:28219804-28219826 TTGGGGAAGAGGAATGAGGATGG - Intergenic
1178094292 21:29197488-29197510 ATGGGGAGCTGGGAGGAGGATGG - Intronic
1178164877 21:29962122-29962144 ATGGGGAGCTGGGAAAGGGATGG + Intergenic
1178213738 21:30569208-30569230 ATGGGGAGCTGGAAGGTGGAGGG - Intergenic
1178818078 21:35949903-35949925 GTGATGAGATGGGATGAGGATGG - Intronic
1179062364 21:37990772-37990794 ATCGGGGGGTGGGAGGAAGAGGG - Intronic
1179081181 21:38172037-38172059 TTGGGGAAGAGGCATGAGGAGGG + Intronic
1179130316 21:38630451-38630473 ACAGGGAGGTGGGAGGAGGAAGG + Intronic
1179131187 21:38638803-38638825 AAGGGGATGTGGGAGGAGGAGGG - Intronic
1179181325 21:39047535-39047557 AGGGGGAGGGGAGAGGAGGAAGG + Intergenic
1179245511 21:39630755-39630777 ATGGGGAGGTAAGGTGAGGCAGG + Intronic
1179269796 21:39841662-39841684 AGGGGGCGATGGGAGGAGGATGG + Intergenic
1179415062 21:41191908-41191930 TTGGGGAAGAGGGATGTGGATGG - Intronic
1179440009 21:41386909-41386931 GTGGAAAAGTGGGATGAGGAAGG - Intronic
1179519332 21:41931968-41931990 GTGGGGAGGTGGGATGCTGGAGG - Intronic
1179519340 21:41931990-41932012 GTGGGGAGGTGGGATGCTGGAGG - Intronic
1179551495 21:42146597-42146619 CTGGGGAGGAGGGCTGAGGTTGG + Intergenic
1179845331 21:44107760-44107782 ATGAGGAGGTGGGACGGGGCGGG + Intronic
1179890738 21:44333971-44333993 ATGGGGAGGGGGGCTCAGGACGG - Intronic
1180012257 21:45058731-45058753 ATGGGGACATGGAATGGGGAGGG + Intergenic
1180104279 21:45607649-45607671 GAGGGGAGGAGGGATGAGAAAGG + Intergenic
1180182455 21:46124080-46124102 ATGGGTGGGTGGGTAGAGGATGG + Intronic
1180356715 22:11849210-11849232 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1180381546 22:12143121-12143143 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1180488018 22:15819257-15819279 TTAGGGAGTTGGGAAGAGGAAGG + Intergenic
1180562714 22:16633644-16633666 ATGGGGTGGGGGGATGGGGGAGG - Intergenic
1180743071 22:18067264-18067286 CTGGAGAGGGGGGATCAGGAAGG - Intergenic
1180825589 22:18858721-18858743 ACCCGGAGGTGGGGTGAGGACGG + Intronic
1181174461 22:21027855-21027877 ATGGGGAGGTGGGCTCTGAAGGG + Exonic
1181187144 22:21115826-21115848 ACCCGGAGGTGGGGTGAGGACGG - Intergenic
1181212057 22:21294667-21294689 ACCCGGAGGTGGGGTGAGGACGG + Intergenic
1181397440 22:22632219-22632241 ACCCGGAGGTGGGGTGAGGACGG - Intergenic
1181500191 22:23311594-23311616 ACCCGGAGGTGGGGTGAGGACGG - Intronic
1181520752 22:23448269-23448291 CTGGGGATGCGGGGTGAGGAGGG - Intergenic
1181589717 22:23876689-23876711 GCGGGGGGGTGGGAGGAGGAAGG - Intronic
1181651968 22:24263843-24263865 ACCCGGAGGTGGGGTGAGGACGG + Intergenic
1181705410 22:24646900-24646922 ACCCGGAGGTGGGGTGAGGACGG - Intergenic
1181756843 22:25029856-25029878 GTGGGGAGGTGGGAGCTGGATGG + Intronic
1181886083 22:26023504-26023526 AAGAGGAGGAGGGAGGAGGAGGG - Intronic
1181905652 22:26193596-26193618 TTGGTGCAGTGGGATGAGGATGG - Intronic
1181961253 22:26623234-26623256 ATGGTGGTGTGGGATGAGGACGG + Exonic
1181969242 22:26677796-26677818 AGGAGGAGGTGGGGTGAGGGTGG + Intergenic
1181971198 22:26691365-26691387 CTGGGTAGGTTGGAGGAGGATGG + Intergenic
1181976692 22:26735991-26736013 ATGGTGGGATGGGATGGGGAGGG - Intergenic
1181976706 22:26736036-26736058 AGGTGGGGGTGGGATGGGGAGGG - Intergenic
1182110148 22:27717474-27717496 ACTGGGAGTTGGGATGAGGGTGG - Intergenic
1182243177 22:28933781-28933803 AGGGGGAGGAGGGAGGAGGGAGG - Intronic
1182329836 22:29543380-29543402 ATGGGGAGGAGGAAGGAGGAAGG + Intronic
1182330959 22:29551786-29551808 AGGGGGAGGGGGGAGGGGGAGGG - Intronic
1182423777 22:30261239-30261261 ATGGGGAGGCGGGAAGAGCTAGG - Intergenic
1182459958 22:30476503-30476525 AAGGGGAGGGGAGATGGGGAAGG - Intergenic
1182630800 22:31683803-31683825 ATGGGGAGATGGGTTGGGGGTGG - Exonic
1182662860 22:31937263-31937285 ATGGGGTGGAGGGATGGGAAAGG + Intronic
1182879980 22:33724923-33724945 AAGGTGGGGTGGGAGGAGGAGGG + Intronic
1182900337 22:33893274-33893296 CTGGGGTGGTGGGAAGAGGAAGG - Intronic
1182931386 22:34177480-34177502 AGGGAGAGGTGGAAGGAGGAGGG - Intergenic
1183145018 22:35982366-35982388 ATGGGGAGATGGGGGGAGGAGGG - Intronic
1183152313 22:36047517-36047539 TGGGGGTGGTGGGATGGGGATGG - Intergenic
1183225684 22:36548529-36548551 CTTGGAGGGTGGGATGAGGATGG + Intergenic
1183409858 22:37648452-37648474 TGGGGGAGGTGGCAGGAGGAAGG + Intronic
1183467129 22:37985412-37985434 AGGGAGAGGTGGGCAGAGGAGGG - Intronic
1183532409 22:38366492-38366514 ATGGGGTGGGGGGATGGGGGAGG + Intronic
1183556378 22:38530472-38530494 GGGGGGAGGTGAGATGGGGAGGG + Intronic
1183732760 22:39627881-39627903 ATGGGGAGATGAAATGAGGGGGG + Intronic
1184017197 22:41795228-41795250 ATGGGGAAGTGGGGTAAGTAAGG - Intronic
1184302056 22:43567158-43567180 ATAGAGAGCTGGGAGGAGGAGGG - Intronic
1184407192 22:44306881-44306903 TCGGGGAGGTGTGATGATGATGG + Intronic
1184455432 22:44607278-44607300 ATGGGGATGGAGGAGGAGGAGGG + Intergenic
1184550329 22:45201000-45201022 ATGGGGAGGAGGGAGGAGATGGG - Intronic
1184561642 22:45267267-45267289 GAGGGGAGGGGGGATGAAGAGGG + Intergenic
1184600081 22:45538217-45538239 TTGGGATGCTGGGATGAGGATGG + Intronic
1185055980 22:48578574-48578596 ATAGGAAGGTGGGATGAGGATGG + Intronic
1185089350 22:48757144-48757166 AGGAGGAGGAGGGAGGAGGAGGG + Intronic
1185199379 22:49492206-49492228 CTGGGGAGGTAGGAGGAGGGCGG - Intronic
1185267278 22:49910989-49911011 ATGAGGAGGTGGGATGTGGCAGG + Intronic
1185272543 22:49935721-49935743 GTGGGGATGTGGGAGGAGCAGGG + Intergenic
1185348281 22:50320099-50320121 CTGGGCAGATGGGATGAGGAGGG - Intronic
1185368733 22:50448775-50448797 AGGGGGAGGTGGCAAGAGGGAGG + Intronic
1203214898 22_KI270731v1_random:765-787 ACCCGGAGGTGGGGTGAGGACGG - Intergenic
1203275741 22_KI270734v1_random:84628-84650 ACTCGGAGGTGGGGTGAGGACGG + Intergenic
949437982 3:4049896-4049918 ATGGGGAGCTGGAAGGGGGATGG + Intronic
950044885 3:9943246-9943268 ATGGGCAGGTGGGGGAAGGAAGG + Intronic
950122289 3:10489774-10489796 ATGGGTTGGAGGGATGAGGCTGG - Intronic
950198458 3:11026204-11026226 AGGGAGGGGTGGGGTGAGGAGGG - Intronic
950238241 3:11342354-11342376 ATGGGGAGCTGGGAGATGGAAGG - Intronic
950436015 3:12980648-12980670 ACGGGGAGGGGAGATCAGGAGGG + Intronic
950523936 3:13512677-13512699 ACGGGGAGGTGGGTTCAGCAGGG + Intergenic
950650594 3:14404333-14404355 ATGAGGAGGTGGGGTGGGGGAGG + Intronic
950786195 3:15437931-15437953 CTGGGGAGGTGGGAAGAGACTGG - Intronic
950979438 3:17286789-17286811 ATGGAAAGGTGGTCTGAGGATGG + Intronic
951004353 3:17599455-17599477 ATGGGGAGCTGGAAAGGGGATGG - Intronic
951074237 3:18369710-18369732 ATGGGGGGGTGGGAGGAAAAAGG + Intronic
951194143 3:19804718-19804740 AGGGGGAGGAGGGAGGAGGAGGG + Intergenic
951535380 3:23735903-23735925 ATGGGGAATTGGGACCAGGAAGG + Intergenic
951658634 3:25037364-25037386 ATGGGGTGGAGGGAGGAGGGAGG + Intergenic
951914908 3:27790347-27790369 ATAGGGAGGGGTAATGAGGAGGG + Intergenic
952039212 3:29241318-29241340 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
952441414 3:33333759-33333781 ATGGGTTGGTGGGGTGGGGAAGG - Intronic
952749551 3:36814366-36814388 ATGGGGAGGAGGGAAGAGCAAGG - Intergenic
953293320 3:41688181-41688203 GGGAGGGGGTGGGATGAGGATGG - Intronic
953383561 3:42492193-42492215 TAGGGGAGGAGGGATGAGGAAGG - Intronic
953535402 3:43773460-43773482 AGGAGGAGGTGTGAGGAGGAGGG + Intergenic
953538403 3:43793391-43793413 ATGGGGAAGTGAGATCGGGAAGG + Intergenic
953578738 3:44134486-44134508 GTGGGAAAGTGGGATGTGGAAGG + Intergenic
953778457 3:45843237-45843259 ATGGGGAGGTGGGATGGTAAAGG - Intronic
953809609 3:46100757-46100779 AGGGAGAGGTGGGATGGTGAAGG + Intergenic
954029659 3:47809707-47809729 GTGGGGAGGTGGGGAGTGGAGGG - Intronic
954121848 3:48504239-48504261 AGGAGGAGGAGGGAGGAGGAGGG + Exonic
954142677 3:48617405-48617427 AAGGGAAGGTGGGTTGAAGATGG + Intergenic
954368423 3:50157856-50157878 ATGGGGAGGGGGGAGGCGGGAGG + Intronic
954441665 3:50525553-50525575 AGGGGGAGGTGGGATGCTCAGGG - Intergenic
954539661 3:51385187-51385209 ATGGGGAAGTGGCATGTGGGAGG + Exonic
954876531 3:53806201-53806223 AGGGGGAGGAGGGAAGATGAGGG - Intronic
955103986 3:55878396-55878418 ATGGGGAGATGGTGGGAGGAAGG - Intronic
955429016 3:58822436-58822458 GTGGGGTGGTGGGAGGGGGAAGG + Intronic
955681967 3:61511659-61511681 TTGGGGAGTTGGGATGGAGAGGG + Intergenic
955874300 3:63474039-63474061 AGTGGGCGGTGGGATGGGGAAGG + Intronic
955969202 3:64420135-64420157 GTGGGGAGGTGGGAAGAGAATGG + Intronic
956065481 3:65393044-65393066 ATGGTGACGTGGGATTATGATGG - Intronic
956135930 3:66098977-66098999 AAGGGGAGGGGAGAGGAGGAAGG - Intergenic
956409716 3:68966967-68966989 ATGGGGTGGGGGGCAGAGGAAGG + Intergenic
956509749 3:69981002-69981024 TTGGGGAGGAGGTATGTGGATGG + Intergenic
956513574 3:70021152-70021174 GTGGGGAGGTGGGAAGAGAAGGG + Intergenic
956655435 3:71546122-71546144 GTGGGGAGGTGGGTGGGGGAAGG - Intronic
956664640 3:71631044-71631066 AATGGGAAGAGGGATGAGGAAGG - Intergenic
956824792 3:72987901-72987923 GTGGGGAAGTGTGATGGGGATGG - Intronic
956920754 3:73926730-73926752 TTGGGGTAGAGGGATGAGGAAGG - Intergenic
956985234 3:74690786-74690808 GGGGGGAGGTGGGATGGGGGAGG + Intergenic
957223221 3:77411041-77411063 AAGCTGAGGTGGGAGGAGGATGG - Intronic
957342895 3:78923655-78923677 CTGGAGAGGTGGCTTGAGGAAGG - Intronic
957586530 3:82139413-82139435 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
957713395 3:83893325-83893347 ATGGGGTGGGGGGAGGGGGAAGG + Intergenic
958111286 3:89149625-89149647 GTGGGGAGGGGGGAGGGGGAGGG - Intronic
958579498 3:95999850-95999872 GTGGGGAGATGTGATGAGTAGGG + Intergenic
958877735 3:99635039-99635061 ATGGAGAGGAGGGATGAGGAGGG - Intergenic
959051863 3:101532078-101532100 ATGTGGAGGTGGGGTGGGGGTGG - Intergenic
959065213 3:101648982-101649004 ATGGGGAGCTGGAAAGGGGATGG + Exonic
959164387 3:102758731-102758753 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
959375512 3:105584334-105584356 ATGGGGAGTTGGAAAGGGGATGG - Intergenic
959694186 3:109231873-109231895 ATGGGGAGCTGGAAAGTGGATGG - Intergenic
960251837 3:115463819-115463841 AGGGGGAGGGGGGAGGGGGAGGG + Intergenic
960358178 3:116678771-116678793 ATGGAGAGCTGGAATGGGGATGG - Intronic
960722943 3:120642409-120642431 CTGGGCATGTGGAATGAGGAGGG + Intronic
960736831 3:120790349-120790371 GTGGGGAGGTGGGTTGGGGATGG + Intergenic
960893394 3:122475922-122475944 CTGAGGAGGAGGGAAGAGGAAGG + Intronic
960945855 3:122966116-122966138 ATGGGAAGTGGGGAGGAGGAGGG - Intronic
961394539 3:126578035-126578057 ATTGAGAGGTTGGATGTGGAGGG + Intronic
961516407 3:127440205-127440227 ATGTGGGGGTGGGGTGGGGAAGG - Intergenic
961647813 3:128401730-128401752 ATAGCCAGGTGGGATGAGGGAGG + Intronic
961801899 3:129457389-129457411 AGGGTGAGGTGGGTTGTGGAAGG - Intronic
962151193 3:132895073-132895095 GTGGGGTGGGGGGATGGGGAGGG + Intergenic
962329653 3:134466301-134466323 TGGGGAAGGTGAGATGAGGAGGG - Intergenic
962821459 3:139051614-139051636 GTGGGGTGGGGGGAGGAGGAGGG - Intronic
963234713 3:142945532-142945554 ATGGGGAGGTGGAAGGGGGATGG + Intergenic
963722528 3:148879259-148879281 ATGGGGGTTTGGGATGTGGATGG - Intronic
963983882 3:151569875-151569897 ATGGGGTGGGGGGATGGGGGAGG - Intergenic
964136577 3:153351532-153351554 ATGGGGAGTTGGAAGGGGGATGG + Intergenic
964139557 3:153381370-153381392 ATTGGCAGGTGGGATGAGGGTGG + Intergenic
964374398 3:156035398-156035420 AGGAGGAGGAGGGAGGAGGAAGG - Intergenic
964842551 3:161010144-161010166 ATGGGGTGGGGGGAGGAGGAGGG - Intronic
965085319 3:164088750-164088772 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
965300827 3:167002553-167002575 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
965328864 3:167344207-167344229 ATAGGGAGATAGGAGGAGGATGG + Intronic
965518342 3:169646307-169646329 ATGGGGTGGGGGGAGGGGGAGGG + Intronic
966265142 3:178031359-178031381 TTGGAGAGGTAGGATAAGGAAGG - Intergenic
966391653 3:179459157-179459179 ATGGGGGGTTGGGAAGAGTAAGG - Intergenic
966473540 3:180319331-180319353 AAGGGGAAGTAAGATGAGGATGG - Intergenic
966804448 3:183795690-183795712 ATAGGGAGGTGGAATGGGGTTGG + Intronic
966937743 3:184724821-184724843 ATGGGGAGGAGGGAGCATGATGG - Intergenic
966940867 3:184746308-184746330 ATGGGGAGGTGGCGTGAAGAAGG - Intergenic
967122920 3:186399588-186399610 CTGGGAGGGTGGGATGAAGAAGG + Intergenic
967132923 3:186489096-186489118 CTGGCTATGTGGGATGAGGAGGG - Intergenic
967473620 3:189890762-189890784 AGAGGGAGGAGGGAAGAGGAAGG - Intronic
967529618 3:190533537-190533559 AAGGGGACTTAGGATGAGGAAGG + Intronic
967911174 3:194543725-194543747 TGGGGGAGGAGGGATGAAGAGGG - Intergenic
968057813 3:195706016-195706038 AGGGGGAGATAAGATGAGGACGG - Intergenic
968478623 4:824463-824485 AGCGGGAGGTGGGGTGGGGAGGG - Intronic
968530095 4:1086908-1086930 ATGGGGTGGGGGCAAGAGGATGG + Intronic
968596611 4:1489338-1489360 CTGGGGAGGTGGGAGGCGGCAGG - Intergenic
968607996 4:1544619-1544641 ACGGGGAGCTGGGGAGAGGATGG + Intergenic
968615007 4:1573777-1573799 AGGGGGAGCTGAGATGAGGGAGG - Intergenic
968615021 4:1573829-1573851 AGGGGGAGCTGAGATGAGGGAGG - Intergenic
968615044 4:1573915-1573937 AGGGGGAGCTGAGATGAGGGAGG - Intergenic
968701688 4:2060619-2060641 GGGGGGAGGGGGGAGGAGGAAGG - Intronic
968730659 4:2267863-2267885 TTGGGGAGGTGGGACGAGGTGGG - Intergenic
968751476 4:2391637-2391659 TGGGGGAGGTGGAATGGGGAGGG - Intronic
968889283 4:3359165-3359187 AGGGGGAGGAGGGAGGAGGAGGG - Intronic
968964697 4:3764006-3764028 GTGAGGAGGTGTTATGAGGAAGG - Intergenic
969122632 4:4921202-4921224 GTGGGGAGGTGAGGTTAGGAAGG - Intergenic
969344147 4:6560858-6560880 TTGGGGAGGTGGCAGGAGGCAGG - Intronic
969520251 4:7674017-7674039 AGGGGGAGCTGAGGTGAGGAGGG + Intronic
969563388 4:7963436-7963458 CTGGGGAGAAGGGCTGAGGATGG + Intergenic
969717908 4:8877343-8877365 AGGAGGAGATGGGAGGAGGAAGG + Intergenic
970046641 4:11861847-11861869 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
970304241 4:14715045-14715067 ATGGGGTGGGGGGAGGGGGAAGG + Intergenic
970496703 4:16633286-16633308 ATGGGGTGGAGGGATGGGGGAGG + Intronic
970619296 4:17800831-17800853 AAGTGGAGGTGGGAGGAGGTAGG - Exonic
970911618 4:21283649-21283671 ATGGGGAGGGGGGAGGGGGGAGG + Intronic
970985940 4:22158250-22158272 ATGGGGTGTTGGGATGGGGGAGG - Intergenic
971447968 4:26772614-26772636 TTGGGGGTGTGGGATGAGGGAGG - Intergenic
971558282 4:28040838-28040860 TTGGGGATGTGGGAGGAGGATGG + Intergenic
971840239 4:31842198-31842220 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
973112219 4:46410646-46410668 ATGGGGTGGGGGGCTGAGGGAGG + Intronic
973193125 4:47409377-47409399 ATGGGGAGCTGGAAAGAGGCTGG + Intronic
973670603 4:53213797-53213819 GTGGGGTGGTGGGAGGAGGGAGG - Intronic
973807629 4:54540923-54540945 GTGGGGAGGTGTGAAGGGGAGGG - Intergenic
973992075 4:56419089-56419111 CTGGGGATGAGGGATGAGGCAGG + Intronic
974470752 4:62315225-62315247 ATGGGGTGGGGGGAGGGGGAGGG + Intergenic
974978122 4:68917479-68917501 ATGGGGAGCTGGAATGGTGATGG + Intergenic
974987130 4:69042017-69042039 ATGGAGAGCTGGGATGGTGATGG - Intronic
975267976 4:72393495-72393517 ATTGGGAGGTGGGATGCTAAGGG - Intronic
975298451 4:72761862-72761884 AGGGTGTGGTGGGAGGAGGACGG - Intergenic
975580909 4:75906346-75906368 ATGGGGAGCTGGAACGGGGACGG - Intergenic
975684447 4:76905741-76905763 ATGGGGAGGAGGGAACAGGATGG + Intergenic
975707785 4:77128121-77128143 AAGGGGAGCTGGAATGGGGATGG + Intergenic
975748111 4:77494441-77494463 ATGGGGAGGGGTGTTGGGGAAGG - Intergenic
975979841 4:80144888-80144910 GTGGGGAAGTGAGATGAGGAAGG - Intergenic
976187601 4:82458094-82458116 ATCGGCAGCTGGGATGAGGCAGG + Intronic
976370196 4:84279181-84279203 GTTGGGAGCTGGGATGAGGCAGG - Intergenic
977291650 4:95171375-95171397 AGGGGGAGGTGGGAGGGGGGAGG - Intronic
977306295 4:95327773-95327795 AAGGGGAGCTGGAAGGAGGATGG - Intronic
977828108 4:101557334-101557356 CTGGGGAAGTGGGGTGAGGGTGG - Intronic
977840204 4:101693931-101693953 GGAGGGAGGTGTGATGAGGATGG - Intronic
977900342 4:102415122-102415144 ATGGGGTGGGGGGAGGGGGAGGG + Intronic
978584289 4:110261081-110261103 AATGAGACGTGGGATGAGGAAGG + Intergenic
979018461 4:115464960-115464982 ATGGGGTGGGGGGATGGGGGAGG - Intergenic
979208741 4:118075043-118075065 ATGGGGTGGGGGGATGGGGAAGG - Intronic
979395569 4:120184434-120184456 TTGGGGAGGCGTGATGTGGATGG + Intergenic
979728403 4:123992247-123992269 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
979919309 4:126478520-126478542 ATGGGGAGCTGGAAAGAAGATGG - Intergenic
979960513 4:127015311-127015333 ATTGGGATGAGGAATGAGGAAGG - Intergenic
980092217 4:128454828-128454850 ACAGGAAGGTGGGATGAAGACGG + Intergenic
980097039 4:128501894-128501916 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
980503441 4:133685319-133685341 ATGGGGTGGTGGGAGGGGGGAGG - Intergenic
980568854 4:134583460-134583482 AAGTGGTGGTGGGATGGGGATGG - Intergenic
980714740 4:136614819-136614841 ATGGTGATGTAGGATGTGGAAGG - Intergenic
980977925 4:139628818-139628840 ATGGGGAGGGAGGGTGAGGCCGG + Intergenic
981088743 4:140710733-140710755 GTGGGGGGGTGGTCTGAGGAAGG + Intronic
981140728 4:141265666-141265688 ATGGGTAGTTGGGAGGAGAAAGG + Intergenic
981362769 4:143866549-143866571 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
981532435 4:145765353-145765375 ATGGGGTGGAAGGATGGGGAGGG - Intronic
981592247 4:146376602-146376624 ATGGGGAGCTGGAAAGGGGATGG - Intronic
981692285 4:147522965-147522987 AAGTGGAGGTTGGGTGAGGAGGG + Intronic
981815859 4:148829867-148829889 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
982158188 4:152541106-152541128 ACGGAGAGGTGGGCAGAGGAGGG - Intergenic
982245828 4:153349479-153349501 ATTGGCAGATGGGATGAGAAAGG - Intronic
982324802 4:154119394-154119416 AAGGTGAGCTGGGAGGAGGAAGG + Intergenic
982687814 4:158513038-158513060 AAGGGCAGGTGGGAGGAGGATGG - Intronic
982712884 4:158775564-158775586 ATGGGAGGGTGGGATGGGGATGG + Intronic
982819614 4:159929209-159929231 GTGGGGTGGGGGGATGAGGGAGG - Intergenic
982918461 4:161244615-161244637 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
982997923 4:162374839-162374861 ATGGGAAGGAGGGGTAAGGAAGG - Intergenic
983134135 4:164058627-164058649 ATGGGGAGGTGGCAGGATGCAGG - Intronic
983285043 4:165728524-165728546 CTTGGGAGGTGGGATAATGAGGG - Intergenic
983324276 4:166233491-166233513 CTGGGTAGGTGGCATGTGGACGG + Intergenic
983706745 4:170670301-170670323 ATGTGGTGGTGTGTTGAGGAAGG + Intergenic
983810195 4:172051473-172051495 AGGGGGAGCTGGAATGGGGATGG + Intronic
984400222 4:179254523-179254545 ATGGGCAGGTGAGACCAGGATGG - Intergenic
984718817 4:182951668-182951690 ATGCGGAGCTGGAAAGAGGATGG + Intergenic
985113230 4:186567332-186567354 ATGGGCGGGAGGGATGAGGGTGG - Intergenic
985228143 4:187784675-187784697 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
985269906 4:188184041-188184063 ATGGGGAGGTGGAGAGGGGATGG - Intergenic
985279029 4:188269035-188269057 ATAGGGAGGAGGGAGGAGGCGGG - Intergenic
985279045 4:188269085-188269107 ATAGGGAGGAGGGAGGAGGCGGG - Intergenic
985279061 4:188269135-188269157 ATAGGGAGGAGGGAGGAGGCGGG - Intergenic
985279077 4:188269185-188269207 ATAGGGAGGAGGGAGGAGGCGGG - Intergenic
985279093 4:188269235-188269257 ATAGGGAGGAGGGAGGAGGCGGG - Intergenic
985279109 4:188269285-188269307 ATAGGGAGGAGGGAGGAGGCGGG - Intergenic
985279125 4:188269335-188269357 ATAGGGAGGAGGGAGGAGGCGGG - Intergenic
985279141 4:188269385-188269407 ATAGGGAGGAGGGAGGAGGCGGG - Intergenic
985279157 4:188269435-188269457 ATAGGGAGGAGGGAGGAGGCGGG - Intergenic
985279173 4:188269485-188269507 ATAGGGAGGAGGGAGGAGGCGGG - Intergenic
985279189 4:188269535-188269557 ATAGGGAGGAGGGAGGAGGCGGG - Intergenic
985279205 4:188269585-188269607 ATAGGGAGGAGGGAGGAGGCGGG - Intergenic
985279221 4:188269635-188269657 ATAGGGAGGAGGGAGGAGGCGGG - Intergenic
985279237 4:188269685-188269707 ATAGGGAGGAGGGAGGAGGCGGG - Intergenic
985279253 4:188269735-188269757 ATAGGGAGGAGGGAGGAGGCGGG - Intergenic
985293181 4:188407019-188407041 ATGGGGAGCTGGAAGGTGGATGG - Intergenic
985971022 5:3378548-3378570 AAGGGGAGGAGGGAGGAGAATGG - Intergenic
986105881 5:4658925-4658947 ATGAGGAGAGGGGGTGAGGAGGG + Intergenic
986230964 5:5864561-5864583 ATGGGGAGCTGGAAGGTGGAGGG + Intergenic
986501136 5:8401051-8401073 ATGGTGAGGAGGGTTGAGGGAGG + Intergenic
986879088 5:12147840-12147862 AGGGGGAGGGGGTATGGGGAAGG - Intergenic
987026768 5:13934774-13934796 CTGGGGAGGTGGCAAGAGGCAGG + Intronic
987190225 5:15469921-15469943 ATGGGGAGCTGGTAAGGGGATGG + Intergenic
987250983 5:16101127-16101149 ATGGAGAGATGAGATGTGGATGG - Intronic
987251755 5:16107906-16107928 ATGGGGAGCTGGAAGGGGGATGG - Intronic
987280935 5:16412976-16412998 AGGAGTAGGTGAGATGAGGAAGG - Intergenic
987306258 5:16640588-16640610 AGGGAGGGGAGGGATGAGGAGGG + Intergenic
987533356 5:19150225-19150247 ATGGGGTGGAGGGATGGGGGAGG - Intergenic
987715057 5:21557734-21557756 ATGGGGAGTTGGAAAGGGGATGG + Intergenic
988457621 5:31400641-31400663 ATGGGGAGCAGGAAGGAGGAGGG - Exonic
988629207 5:32911092-32911114 ATGGGGAGAAGTGAAGAGGATGG + Intergenic
988776519 5:34482303-34482325 GTGGGGAGCTGGGAAGGGGATGG - Intergenic
988793401 5:34630125-34630147 CTGGGGAGGTGGGGAGAGGAGGG - Intergenic
988859725 5:35264953-35264975 ATTGGATGGTGGGATGAAGAAGG + Intergenic
988947809 5:36224097-36224119 ATGGGGAAGAGAGATGAGTAGGG + Intronic
988981378 5:36572740-36572762 ATGGGCAGGTGGAATAGGGATGG - Intergenic
989384703 5:40843777-40843799 ATGGGGATGGGGGATGAAAAAGG + Intronic
989558597 5:42825591-42825613 ATGGGGAGCTGGAAAGCGGATGG - Intronic
990079843 5:51899500-51899522 ATGGGGAACTGGAAAGAGGATGG + Intergenic
990099719 5:52166965-52166987 ATGGGGTGGGGGGAGGGGGAGGG - Intergenic
990128405 5:52548322-52548344 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
990379721 5:55210925-55210947 ATGGGGAGGTGGTAAGAGGAAGG + Intergenic
990468958 5:56095727-56095749 ATTGGAAGGTGGGAGGAGGACGG - Intergenic
990597931 5:57329925-57329947 ATGGGAAGGAGGCAGGAGGATGG - Intergenic
991030231 5:62074842-62074864 AAAGGGAGGGGGGATAAGGAGGG + Intergenic
991079039 5:62575565-62575587 TGGGGGAGGTGGGGAGAGGATGG - Intronic
991084871 5:62639476-62639498 ATGGTGGGGTGGGAGGAGGTGGG + Intergenic
991115532 5:62950444-62950466 ATGGGGAGGGGGGAGGAGGGAGG - Intergenic
991207450 5:64065892-64065914 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
991425725 5:66489736-66489758 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
991553192 5:67866137-67866159 ATGGGGTGGGGGGATGGGGGAGG - Intergenic
991666995 5:69009339-69009361 AGGCTGAGGTGGGAGGAGGAAGG - Intergenic
992080708 5:73232967-73232989 ATGGGGAGGAGGGCAGAGAAGGG - Intergenic
992116311 5:73541382-73541404 CAAGGGAGGTGGGAAGAGGAAGG + Intergenic
992183523 5:74221840-74221862 ATGGGGTGGGGGGAGGGGGAGGG - Intergenic
992226086 5:74620787-74620809 ATGGGGAGCTGGAAAGAGGATGG + Intergenic
992251188 5:74877371-74877393 GTAGGGAGGTGGGATGATAATGG - Intergenic
992299488 5:75363762-75363784 TAGGGCAGGTGGGGTGAGGATGG - Intergenic
992368137 5:76114237-76114259 ATGGTGATGGGGGATGGGGAGGG - Intronic
992422641 5:76621972-76621994 ATGGAAAAGAGGGATGAGGAAGG - Intronic
992938798 5:81740974-81740996 TGTGGGAGGTGGCATGAGGATGG - Intronic
993062433 5:83054888-83054910 GTGGGGTGGTGGGATGCAGAAGG - Exonic
993340376 5:86718249-86718271 ATGGGGAAGAGGGAGGAGGAAGG - Intergenic
993401007 5:87450957-87450979 ATGGGGATGGGGCATAAGGATGG + Intergenic
993528305 5:88993628-88993650 ATGGGGTGGGGGGAAGGGGAGGG + Intergenic
993628900 5:90259831-90259853 ATTGGGGAGTGGGAGGAGGAAGG + Intergenic
994248917 5:97514055-97514077 GTGGGGAGGTGGGAGGGGGGAGG - Intergenic
994672394 5:102778151-102778173 GTGGGGAGGTGAGAGGAGAAAGG - Intronic
994819290 5:104628132-104628154 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
994996106 5:107065314-107065336 TTGGGGTGGGGGGATGGGGAAGG - Intergenic
994999029 5:107103482-107103504 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
995060341 5:107806387-107806409 TTGGGGAGGAGGGATGAGGTGGG - Intergenic
995121131 5:108536202-108536224 ATGGAGAGCTGGAAAGAGGATGG - Intergenic
995142460 5:108749045-108749067 GGGGGGAGGGGGGAAGAGGAGGG + Intronic
995336376 5:111004546-111004568 AAGAGGAGGTGGGATGGGAAGGG - Intergenic
995494484 5:112726336-112726358 ATGGGGAGCTGGAAGGGGGATGG + Intronic
995821572 5:116240269-116240291 AAGGTAAGGTGAGATGAGGAGGG + Intronic
996136099 5:119844194-119844216 ATGGTGAGGTGGGACGGAGAAGG + Intergenic
996171690 5:120300602-120300624 TTGAGGAGGTGGAATGGGGATGG + Intergenic
996242064 5:121215915-121215937 ATGGGGAGCTGGGAAGAGAATGG - Intergenic
996340138 5:122428735-122428757 GTGGGGTGGGGGGATGGGGAAGG - Intronic
996576729 5:124983967-124983989 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
996890332 5:128411427-128411449 ATGGGGAGGTGGAAAGCGGACGG + Intronic
997663028 5:135603859-135603881 AGTGGGAGGTGGGAGGTGGAGGG + Intergenic
997766003 5:136503989-136504011 ATGGGGATGAGGCAGGAGGAAGG - Intergenic
998165217 5:139838812-139838834 ATGGGGGCCTGGGCTGAGGATGG - Intronic
998352739 5:141511938-141511960 ATGGGGTGGTAAGATAAGGAAGG + Exonic
998585643 5:143423945-143423967 GTGGGGAGGGGGGATAAAGAGGG + Intronic
998604040 5:143615506-143615528 AGGGGGAGGGAGGAGGAGGAAGG - Intergenic
998791162 5:145767323-145767345 ATGGGGAGCTGGAAAGGGGATGG - Intronic
999165952 5:149550007-149550029 ATGGGGAAGTGGGTAGAGGCAGG - Intronic
999666741 5:153920613-153920635 ATGGGGAGGTGGGAAGCAGAAGG - Intergenic
999668495 5:153937322-153937344 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1000097250 5:157982690-157982712 AAGGGGAGGTGGGGTGGGGATGG + Intergenic
1000233456 5:159336258-159336280 AAGGGGAGGTGGAAAGGGGAGGG - Intergenic
1000742511 5:164987230-164987252 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1000865978 5:166515235-166515257 ATGGGGAGGTGGGAGGTAGAAGG - Intergenic
1000867956 5:166538429-166538451 ATGGGGAGTTGGAAGGGGGATGG - Intergenic
1000906878 5:166974929-166974951 CTGGGGAGGGGGGTGGAGGAGGG + Intergenic
1000915440 5:167075458-167075480 ATGGGGATGTGGGAAGAAAAAGG + Intergenic
1000949424 5:167462566-167462588 ATGGGGAGCTGGAAAGGGGATGG + Intronic
1001192430 5:169643405-169643427 ATGGGGAGGTGGGGCGGGGCGGG + Intronic
1001430670 5:171659248-171659270 GTGGGGCGGGGGGATCAGGAGGG + Intergenic
1001568449 5:172715147-172715169 CTGGGGAAGTGGGATGGGAAGGG + Intergenic
1001594807 5:172891341-172891363 ATGGAGAAGAGGGAAGAGGATGG - Intronic
1002762648 6:214046-214068 ATGGGGAGCTGGAAGGAGGAGGG - Intergenic
1003173769 6:3739652-3739674 GTGGGGAGGTGGGCCGAGGCTGG - Intronic
1003470847 6:6430066-6430088 ATGGGGTGGGGGGAGGGGGAGGG + Intergenic
1003793377 6:9572774-9572796 ATGGGGTGGGGGGATGGGGGAGG + Intergenic
1004348097 6:14866872-14866894 GTGGGGAGGTGGGGTGAGCTGGG - Intergenic
1004525575 6:16404402-16404424 AGGGAAAGGTGGGATGAAGAGGG - Intronic
1004629557 6:17408461-17408483 AATGGGAGGTGGGAGGTGGAAGG - Intronic
1004633139 6:17440812-17440834 ATGGGGTGGGGGGATGTGGGAGG - Intronic
1005717925 6:28569297-28569319 AAGGGAAGGTGGGGTGGGGAGGG - Intergenic
1005887679 6:30109178-30109200 GTGGGGAGAGGGGAGGAGGATGG - Intronic
1006174267 6:32112481-32112503 GTGGGGAGAAGGGAGGAGGAAGG + Intronic
1006242037 6:32691124-32691146 GTGGGGAGGGGGGAGGAGGGAGG - Intergenic
1006335063 6:33416103-33416125 ATGGGGAGCTGGGCAGAGGCAGG - Exonic
1006385682 6:33729504-33729526 ATGGGAGGGTGGGAGGAGAAAGG + Intronic
1006641602 6:35492270-35492292 ATGGGGAGGGCAGCTGAGGAGGG + Intronic
1006679736 6:35788219-35788241 GTGGGGAGGTGATATGAGGGAGG + Intronic
1006848662 6:37081303-37081325 GTGGGGAGGTGGGGTGGAGAAGG + Intergenic
1006933535 6:37701809-37701831 CTGGGGGTGTGGGATGAGGAGGG - Intergenic
1007274444 6:40663053-40663075 ATGTGGAGGTGGGGTCTGGAGGG - Intergenic
1007350383 6:41269182-41269204 ATGGGGAGGTGGAACTGGGATGG - Intronic
1007596853 6:43056279-43056301 TTTGGGATGTGGGATGATGATGG - Intronic
1007627597 6:43255141-43255163 ATGTGGAGGTGGGAGGGGCAAGG + Intronic
1007694949 6:43726067-43726089 CTGGGGAGTTGGGAGGAGGGCGG - Intergenic
1007897111 6:45374079-45374101 ATGAGAAAGCGGGATGAGGATGG + Intronic
1007995812 6:46306497-46306519 ATGGTAAGGAGAGATGAGGAGGG + Intronic
1008269786 6:49477419-49477441 ATGGGGTGGGGGGAGGGGGAGGG + Intronic
1008724641 6:54402025-54402047 ATGGGGTGGGGGGAGGGGGAGGG - Intergenic
1008753722 6:54768365-54768387 AGGGGTAGATGGGATGAGGCTGG + Intergenic
1008863246 6:56176936-56176958 AGGAGGAGGAGGGAGGAGGAAGG + Intronic
1008921740 6:56850117-56850139 AAGGGGAGGTGGAGGGAGGATGG - Intronic
1009001666 6:57724310-57724332 ATGGGGAGTTGGAAAGGGGATGG - Intergenic
1009844949 6:69122475-69122497 AGGGGGAGGGGGGAGGGGGAGGG + Intronic
1009927658 6:70139472-70139494 ATGGGGTGGTGGGATAATTAAGG - Intronic
1010312802 6:74407140-74407162 ATGGGGTGGGGGGAGGAGGGAGG + Intergenic
1010354151 6:74910779-74910801 GTGGGTAGCTGAGATGAGGAGGG - Intergenic
1010482227 6:76369572-76369594 ATGGGGTGGGGGGAGGGGGAAGG - Intergenic
1010494222 6:76513818-76513840 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1010938156 6:81885792-81885814 TTGGGGAAGGGGGATGTGGATGG - Intergenic
1011049446 6:83128018-83128040 AAGGGGAGGAGGGGTGACGAAGG + Intronic
1011261696 6:85476696-85476718 ATGGGGAGCTGGAAAGGGGATGG + Intronic
1011308227 6:85953045-85953067 GTGGGGTGGGGGGATGAGGGAGG - Intergenic
1011474409 6:87736872-87736894 AGGGGGAGGGGGGAGGGGGAGGG + Intergenic
1011525472 6:88259608-88259630 ATGGGGTGGGGGGAGGCGGAAGG + Intergenic
1012188636 6:96253323-96253345 ATGGGGTGGGGGGAGGGGGAAGG + Intergenic
1012389966 6:98727304-98727326 ATGGGATGGTGGGGAGAGGATGG - Intergenic
1012587078 6:100936539-100936561 ATTGGGAGGTGGAAGGAGGAAGG + Intergenic
1012743694 6:103055046-103055068 ATGGGGAGGTGGAAAGCGGATGG + Intergenic
1012945458 6:105461162-105461184 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1013041163 6:106435268-106435290 AGGCTGAGGTGGGAGGAGGATGG - Intergenic
1013056598 6:106589203-106589225 AGGGGGAGGAGGGAGGAGGAGGG + Intronic
1013091963 6:106908260-106908282 TTGGGGAGGAGGGATGGGGTAGG - Intergenic
1013196674 6:107850362-107850384 ACTGGGAGGGGGCATGAGGAAGG - Intergenic
1013249563 6:108320783-108320805 CTGGGGTGGTAGGATGAGGAAGG + Intronic
1013385217 6:109621741-109621763 GTGGGGAGGGGGGATGGGGGAGG + Intronic
1013461145 6:110376594-110376616 AGGGGGAGGTGGAATGTGGGAGG + Intergenic
1013924098 6:115447191-115447213 GTGGGGTGGGGGGAGGAGGAAGG + Intergenic
1013932191 6:115547013-115547035 ATGGGGAGGGGGGGTGGGTAGGG + Intergenic
1014332326 6:120085504-120085526 ATGGGGAGGGGGCAGGGGGAAGG - Intergenic
1014635628 6:123843317-123843339 ATGGGGAGCTGGAAAGGGGATGG + Intronic
1015061608 6:128973689-128973711 AAGAGGAGGTGGGTGGAGGATGG + Intronic
1015406737 6:132846021-132846043 ATTGTGGGGTGGGAGGAGGAGGG - Intergenic
1015924700 6:138296963-138296985 CTGGGAAGGTGGGAAGAGGCTGG + Intronic
1015963276 6:138671942-138671964 ATAGGGGGGTGGGTTGAGGAAGG + Intronic
1016532797 6:145076540-145076562 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1016985100 6:149889163-149889185 AGTGGGAGGTGGGATGGGAAAGG + Intronic
1017400071 6:154050620-154050642 ATGGGGGGCTGGGAGGAGGTGGG + Intronic
1017463125 6:154670261-154670283 ATTCTGAGGTGGGAGGAGGATGG - Intergenic
1017633611 6:156422844-156422866 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1017637366 6:156456204-156456226 ATGGGGAGGAGGGGGGAGGAAGG - Intergenic
1017637436 6:156456339-156456361 ATGGGGAGGGGAGGGGAGGAAGG - Intergenic
1017637462 6:156456391-156456413 ATGGGGAGGAGGGGGGAGGAGGG - Intergenic
1017782359 6:157725794-157725816 ATGGGGAGTTGGAAAGGGGATGG - Intronic
1018033794 6:159865188-159865210 GTGGGGATGTGGGGTGAAGAGGG + Intergenic
1018201437 6:161399168-161399190 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1018293184 6:162314281-162314303 ATGTGGAGGTGGGGTGAAAAAGG - Intronic
1018461681 6:164004717-164004739 AGGGGGAGGGGGGATGGGGGAGG + Intergenic
1018752906 6:166822628-166822650 ATGGGGTGGTGGGAGGTGGTGGG - Intronic
1018768529 6:166952780-166952802 AAGGGGAGGAGGGGAGAGGAGGG + Intronic
1018985883 6:168636915-168636937 GTGGGGAGGGGGGAGGAGGGAGG - Intronic
1019016867 6:168886283-168886305 TTGAGGAGGTGGGAGGAGAAGGG + Intergenic
1019056004 6:169223994-169224016 GTGGGGAGTGGGGATGAGGTGGG + Intronic
1019153801 6:170025753-170025775 ATGGGGAGGGAGCATGTGGACGG + Intergenic
1019166354 6:170100192-170100214 AGGGGCAGCGGGGATGAGGACGG - Intergenic
1019215185 6:170438821-170438843 CTGGGGTGGTGGGCTGAGGCTGG + Intergenic
1019287273 7:229983-230005 ATGGGGTAGGGGGATGGGGAAGG + Intronic
1019294214 7:265473-265495 ACGGGTAGGTGGGAAGAGGGCGG - Intergenic
1019320690 7:414167-414189 AGGGGGAGGAGGGAGGAGGAGGG - Intergenic
1019320786 7:414393-414415 AGGGGGAGGAGGGAGGAAGAGGG - Intergenic
1019367429 7:642009-642031 TTGGGGAGGAGGGAGGAGGGCGG - Intronic
1019494914 7:1333347-1333369 AGGGGGAGGAGGGGGGAGGAGGG - Intergenic
1019522735 7:1468021-1468043 ATGGGGAAGGAGGATGGGGAGGG - Intergenic
1019590487 7:1827978-1828000 CTGGGGATGCGGGGTGAGGAGGG + Intronic
1019607069 7:1915310-1915332 ACGGGGAGATGGGAGGGGGAGGG + Intronic
1019608248 7:1921012-1921034 GTGGGGAGGTGGGAAGAGGGCGG + Intronic
1019949482 7:4359735-4359757 ATGGGGTGGAGGGAGGGGGAAGG + Intergenic
1020080247 7:5282866-5282888 AGGAGGAGGGGGGAGGAGGAGGG + Intronic
1020283552 7:6663813-6663835 ATGTGGAGGTGGGAGGTGAAGGG + Intergenic
1020406977 7:7847553-7847575 ATGGGCAGTAGGGATGAAGAGGG - Intronic
1020434866 7:8151718-8151740 ATGTGGAGGTGGGTGGAAGAAGG + Intronic
1020452378 7:8334957-8334979 AGGGGTATGTGGGATGGGGAAGG + Intergenic
1020787116 7:12587348-12587370 GTGGGGAGTGAGGATGAGGATGG + Intronic
1021041910 7:15872800-15872822 ATGGGGAGCTGGACAGAGGATGG - Intergenic
1021056451 7:16053297-16053319 GTGGAGGGGCGGGATGAGGATGG - Intergenic
1021212270 7:17869320-17869342 TTGAGAAGATGGGATGAGGAAGG - Intronic
1021333479 7:19368719-19368741 CTCGGGCAGTGGGATGAGGACGG - Intergenic
1021334313 7:19379885-19379907 ATAGGGAGATGGAAGGAGGAAGG - Intergenic
1021373961 7:19884107-19884129 ATGGGGTGGGGGGAAGGGGAGGG - Intergenic
1021379352 7:19948863-19948885 GTGGGGTGGGGGGATGTGGAAGG - Intergenic
1021926709 7:25540807-25540829 ATGGGGAGATGGGGAGGGGATGG + Intergenic
1022013622 7:26330019-26330041 ATGAGGAAGTGCGATCAGGAAGG + Intronic
1022883185 7:34612204-34612226 ATGGGGATCTGGGAAGAGGCTGG + Intergenic
1023003739 7:35840179-35840201 AGGGGGAAGGGGGAGGAGGAGGG - Intronic
1023043312 7:36191382-36191404 CTGGAGAGGTGGGAAGAGGGAGG + Intronic
1023733897 7:43218260-43218282 AAGGGGAGGTGAGAGGAGGCAGG + Intronic
1024012174 7:45278284-45278306 ATGGGAAGATGAGATCAGGAAGG + Intergenic
1024157614 7:46640592-46640614 ATGGGAAGGATGGCTGAGGAGGG + Intergenic
1024610309 7:51058722-51058744 ATGGAGAGGCGTGATGAGGCAGG + Intronic
1024721006 7:52137373-52137395 AGGAGGAGGGGGGAGGAGGATGG + Intergenic
1024738938 7:52335023-52335045 ATGGTGGTGTGGGATGTGGAAGG + Intergenic
1024788308 7:52933763-52933785 ATGGTGAAGTGGGATGTGAATGG + Intergenic
1024962915 7:54996330-54996352 ATGGGGAGGGGGGATGCAGGGGG - Intergenic
1024979612 7:55146342-55146364 ATGGGGAGGAAGGAAGAGAATGG - Intronic
1026104160 7:67407877-67407899 GAGGGGAGGAGGGATGAGGAAGG - Intergenic
1026124718 7:67569435-67569457 ATGAGTGGGTGGGAGGAGGAGGG - Intergenic
1026152644 7:67801313-67801335 ATGATGAGATGGGAGGAGGAAGG - Intergenic
1026308833 7:69166264-69166286 ATGGGGAGGGGGGAAGGGGAGGG + Intergenic
1026308845 7:69166283-69166305 AGGGGGAGGGGGGAAGGGGAGGG + Intergenic
1026593140 7:71713309-71713331 ATGGGGACGAGGGATGAGAAGGG + Exonic
1027570164 7:79856241-79856263 ACGGGGAGGAGGGATAAAGAGGG - Intergenic
1027653920 7:80905189-80905211 TTGAGGAGGTGGGAAGAGGGAGG + Intronic
1027686622 7:81286457-81286479 ATGGGGTGGGGGGATGGGGGAGG + Intergenic
1027888314 7:83937807-83937829 ATGGGGAGTTGGGAGGGGAATGG - Intergenic
1028050605 7:86179951-86179973 ATGGGGTGGGGGGAGGAGGGAGG + Intergenic
1028533799 7:91868390-91868412 ATGGGGTGGATGGATGAAGAAGG - Intronic
1028872287 7:95782799-95782821 ATGGGGAGCTGGAAAGGGGATGG + Intronic
1028943562 7:96552332-96552354 GTGGGGTGGTGGGAGGGGGAGGG - Intronic
1029017277 7:97327507-97327529 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1029181290 7:98703902-98703924 ATGGGGAGCAGGGATGAAGGTGG - Intergenic
1029221814 7:98995970-98995992 ATGGGATGGGGGTATGAGGATGG - Intronic
1029568241 7:101353869-101353891 ATGGGGATATGGGCTGAGCACGG + Intergenic
1029600057 7:101558181-101558203 GTGGGGAAGGGGGATGAGGAAGG - Exonic
1029615166 7:101651893-101651915 ACGAGGAGCTGGGATGGGGAAGG - Intergenic
1029655888 7:101924156-101924178 ATGGGGAGGAGGACAGAGGATGG + Intronic
1030328340 7:108246152-108246174 ATTGGAAGGTGGGATAAAGAAGG - Intronic
1030387166 7:108878209-108878231 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1030740715 7:113106267-113106289 GTGGGGAGAAGGGATGTGGATGG - Intergenic
1030743964 7:113142508-113142530 ATGAGGAAGTGGGATTAGGTGGG - Intergenic
1030869084 7:114733522-114733544 ATGGGGAGGGAGGAGGAGAAGGG + Intergenic
1031527626 7:122840278-122840300 GTGGGGTGGGGGGAGGAGGAAGG + Intronic
1031577642 7:123435189-123435211 TGGGGGAGGTGGGGTGGGGAGGG + Intergenic
1031624466 7:123976162-123976184 ATAATGGGGTGGGATGAGGATGG + Intergenic
1031824649 7:126548165-126548187 GTGGGGTGGAGGGATGAGGAGGG + Intronic
1031993027 7:128210165-128210187 GAGGGGAGGTGGGAGGGGGAGGG + Intergenic
1032061168 7:128726613-128726635 AGGGGGAGGTGGAATGGGGTGGG - Intronic
1033227059 7:139570731-139570753 AAAGGGAGGGAGGATGAGGATGG + Exonic
1033284975 7:140033582-140033604 TTGGGGAGGTGGGATGGGATTGG - Intronic
1033653701 7:143360231-143360253 ATGGGCAGCTGGGGTAAGGAAGG - Intronic
1033666564 7:143446284-143446306 ACGGGCTGGTGGGAAGAGGAGGG - Intergenic
1033767093 7:144505844-144505866 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1033920515 7:146386220-146386242 GAGGGGAGGAGGGATGAGCATGG - Intronic
1034026733 7:147712743-147712765 ATGGGGTGGTGGGAGGAGGGAGG + Intronic
1034201729 7:149286977-149286999 ATGGGGATGTGGTATCAGGCGGG + Intronic
1034260802 7:149754133-149754155 TTGGCGAGGTGGGTTGAGGGTGG - Intergenic
1034276683 7:149826841-149826863 GTGGGGAGCAGGGATGAGGAAGG + Intergenic
1035087034 7:156269102-156269124 ATGGGGAGGAGGGATGGGAGAGG + Intergenic
1035154086 7:156898130-156898152 TTGGGGAGGTGGGCAGAGGCTGG - Intergenic
1035277000 7:157753808-157753830 ATGGGGAGGTGGGCAGGGCACGG - Intronic
1035314467 7:157989599-157989621 AAGGGGTGGAGGGATGAGGGGGG + Intronic
1035671950 8:1424869-1424891 CTGGGGAGGGAGAATGAGGAGGG + Intergenic
1035824397 8:2629083-2629105 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1035899933 8:3448376-3448398 AGGGGGAGGAGGGAGGAGGAAGG + Intronic
1036130398 8:6104263-6104285 ATGGAGAGGAGGGGAGAGGAAGG + Intergenic
1036217100 8:6889877-6889899 AGGGGGAGGGGGGATGGGGAGGG - Intergenic
1036217115 8:6889901-6889923 ACGGGGAGGGGGGATGGGGAGGG - Intergenic
1036664230 8:10728699-10728721 ATGGGGAGGAGAGAGGAGCATGG - Intronic
1037313724 8:17581664-17581686 ATGGTGCGGTGGGAGGAGGAGGG - Intronic
1037539743 8:19859363-19859385 ATGGGGTGGCGGGATGGGGGAGG + Intergenic
1037674155 8:21039977-21039999 AAGGGGAGGTGGGAAGTGGCAGG - Intergenic
1037760410 8:21738159-21738181 ACGGGGGAGGGGGATGAGGAGGG - Intronic
1037887789 8:22604193-22604215 ATGGGGAGGTCGGAGGATAAGGG + Intergenic
1037907349 8:22723385-22723407 ATCGGGAGATGCCATGAGGAGGG - Intronic
1038446932 8:27611007-27611029 CTGTGGAGGTGGCATGGGGAGGG - Intronic
1038694622 8:29795404-29795426 GTGGGGTGGTGGGAAGAGAATGG - Intergenic
1038896888 8:31793882-31793904 ATGGAGAGATGGAAGGAGGAAGG - Intronic
1038919316 8:32065345-32065367 GTGGGGTGGTGGGAGGGGGAAGG - Intronic
1038930543 8:32188810-32188832 GTGGGGTGGGGGGAGGAGGAGGG + Intronic
1038965893 8:32571502-32571524 CTGGGGAGGTGGGAAGAGACAGG - Intronic
1039427177 8:37495523-37495545 TTGGGAAGACGGGATGAGGAAGG - Intergenic
1039542256 8:38382043-38382065 CTCGGGAGGTGGGATGGGAAGGG + Exonic
1039793115 8:40891252-40891274 AGGGGGAGGGGGGAGGGGGAAGG + Intronic
1040412056 8:47164454-47164476 ATGGGGTGGGGGGATGGGGGAGG + Intergenic
1040598743 8:48864176-48864198 AGGTGGAGGAGGGATGAAGAGGG - Intergenic
1041029730 8:53724571-53724593 AGGGGGAGGGGGGAGGAGGGAGG - Intronic
1041109952 8:54474889-54474911 AGTGGGAGATGGGATGGGGAAGG + Intergenic
1041370484 8:57154616-57154638 ATGGGGCAGTGGGATAAGGAGGG - Intergenic
1041665311 8:60438769-60438791 ATGGGGTGGAGGGATGGGGGAGG - Intergenic
1041755958 8:61313382-61313404 CTGAGGAGGTGGGCTGAGGCTGG + Intronic
1042153047 8:65810346-65810368 ATGGGGTGGGGGGATGGGGGAGG + Intronic
1042155122 8:65836896-65836918 AGGGGGAGGAGGAAGGAGGATGG - Intronic
1042176523 8:66042697-66042719 AGGGGGAGGGGGGAGGGGGAGGG - Intronic
1042397409 8:68308002-68308024 GTGGGGAGGGTGGGTGAGGAGGG + Intronic
1042644737 8:70974384-70974406 ATGGGGTGGTGGGATCAGGGAGG - Intergenic
1042833155 8:73053434-73053456 ATGGGGAAGGAGGAGGAGGAGGG - Intergenic
1042939027 8:74089014-74089036 AGGGGGAGATGGGGTGAGAAGGG + Intergenic
1042984371 8:74566688-74566710 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1043130611 8:76456144-76456166 TTGGGGGTGTGGGGTGAGGAAGG + Intergenic
1043544726 8:81302419-81302441 ATGGAGAGGTGGGTTGAGGAGGG - Intergenic
1043577545 8:81675232-81675254 GGGGGGTGGTGGGAAGAGGAAGG - Intronic
1043815108 8:84792279-84792301 ATGGGGAGATGGAAGGGGGATGG + Intronic
1043986400 8:86697783-86697805 ATGGGGTGGGGGGAGGAGGGAGG - Intronic
1043999786 8:86865442-86865464 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1044102456 8:88157813-88157835 ATGGGGTGGGGGGATGGGGGAGG - Intronic
1044221778 8:89678112-89678134 ATGGGGTGGGGGGATGGGGGAGG + Intergenic
1044285887 8:90411817-90411839 TTGGGGAAGAGGTATGAGGATGG - Intergenic
1045038230 8:98194252-98194274 CTGGGTAGGCGGGGTGAGGAAGG + Intronic
1045039868 8:98213201-98213223 CTGGGGAGGTTGAAGGAGGAGGG - Intronic
1045185616 8:99834658-99834680 AGGCTGAGGTGGGAGGAGGATGG - Intronic
1045211878 8:100107235-100107257 ATGGAGAGGTGGGAGGTGGGGGG + Intronic
1045344912 8:101285174-101285196 GTGGGGAGGTGGCACGGGGAAGG - Intergenic
1045347062 8:101302919-101302941 CTGGGAAGATGGGGTGAGGATGG + Intergenic
1046200479 8:110921254-110921276 ATGGGGAGGTTGGGTGGGGGTGG + Intergenic
1046565479 8:115893845-115893867 ATGGGGTGGGGGGAGGGGGAGGG + Intergenic
1046848159 8:118942210-118942232 ATGGGGTGGGGGGAGGGGGAAGG - Intronic
1046936448 8:119889594-119889616 GTGGGGAGGTGGGGAGGGGACGG + Intronic
1047231917 8:123004836-123004858 GTGGGGTGGTGCGATCAGGAGGG - Intergenic
1047359989 8:124160448-124160470 ATGGGGAGATGGGATGGGGATGG - Intergenic
1047415817 8:124663661-124663683 CAGAGGAGGTGGGAGGAGGATGG - Intronic
1047455351 8:125003882-125003904 ATGGGGTGGTGGGGTGGGGTGGG + Intronic
1047470513 8:125167049-125167071 ATGTGGAGGGGAGATGAGGTGGG - Intronic
1047572264 8:126111867-126111889 ATGGGCAAGAGGGAGGAGGAAGG - Intergenic
1047877209 8:129152265-129152287 GTGGGGAGGTGGGAGGGGGGAGG - Intergenic
1047945209 8:129869969-129869991 ATGGGGGGGTGGGGGGAGGGGGG + Intronic
1048283969 8:133127174-133127196 CTGGGGAGGTGGGTTGAGCCTGG - Intronic
1048437907 8:134434766-134434788 AGGGGAAGGAGGGATGAGGTGGG - Intergenic
1048648699 8:136450945-136450967 ATGGGGAGTTGGAAGGGGGATGG + Intergenic
1048676419 8:136788045-136788067 ATAGGGAGGGGTGATGAGGAAGG + Intergenic
1048761256 8:137798146-137798168 ATGGGGAGGAGATATGATGAAGG + Intergenic
1048846737 8:138609602-138609624 ATGGGTTGGTGGGCGGAGGAAGG - Intronic
1048900364 8:139031737-139031759 ATGGGGAGCTGGAAAGGGGAAGG + Intergenic
1049083131 8:140457910-140457932 ATGGGGAGGGAGGAGGAGGAGGG + Intronic
1049122037 8:140747686-140747708 AGGAGGAGGAGGGAGGAGGAGGG + Intronic
1049272908 8:141705539-141705561 ATGGGGAGATGGGGAGATGAAGG + Intergenic
1049371953 8:142272225-142272247 ATGGGTAGATGGAAGGAGGAAGG - Intronic
1049429017 8:142550673-142550695 AAGGGGAGGTGGGGGGAGGAAGG + Intergenic
1049548330 8:143245146-143245168 AGAGGGGGGTGGGACGAGGAGGG + Intergenic
1049832465 8:144710778-144710800 TTGGGGAAGAGGGATGAGGAAGG + Intergenic
1049879326 8:145051694-145051716 ATGGGGTGGAGGGACGTGGAGGG - Intergenic
1050309631 9:4339816-4339838 AGGGGGAGGGGGGAGGGGGAGGG + Intronic
1050325185 9:4491142-4491164 CTGGGGGTGTGGGGTGAGGAAGG - Intronic
1050584556 9:7097070-7097092 ATGTGGGAGTGGGATGAAGAAGG - Intergenic
1050603608 9:7277827-7277849 ATGGGATGGGGGGATGAGGGAGG - Intergenic
1050641969 9:7677933-7677955 GTGGGGTGGTGGGGTGAGGAAGG + Intergenic
1050823467 9:9913820-9913842 AATGGGAGGTGGGAGGTGGAGGG - Intronic
1050874346 9:10615412-10615434 GTGGGGAGGAGGTAGGAGGAAGG - Intergenic
1051130312 9:13852955-13852977 ATGCGGAGGTGGGAGTGGGATGG + Intergenic
1051263471 9:15288534-15288556 ATGGGGAGCTGGAAGGGGGATGG - Intronic
1051288507 9:15521431-15521453 AGGGGGAGGTGGGATGGAGGGGG - Intergenic
1052200560 9:25773777-25773799 ATAAGGAGGTGGGAAGAGGTGGG + Intergenic
1052664650 9:31479229-31479251 ATGGGGTGGGGGGATGATAACGG - Intergenic
1052827594 9:33188188-33188210 ATGGGCAGGAGGGTTGGGGAGGG + Intergenic
1053143878 9:35698996-35699018 ATGGTGAGGGTGGAAGAGGAAGG + Intronic
1053183632 9:35995652-35995674 ATGGTGAGGGGGGCTGAGGGAGG - Intergenic
1053289279 9:36869339-36869361 AGTGGGAGGTGGAGTGAGGAGGG - Intronic
1053357071 9:37455321-37455343 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1054353444 9:64040613-64040635 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1054734087 9:68732902-68732924 ATGTGGAGGTGGGTTGGGGGGGG + Intronic
1054817707 9:69491454-69491476 ATGGGGTGGGGGGAGGTGGAGGG + Intronic
1055029574 9:71759819-71759841 ACGGGGAGGTGGGGGGGGGATGG + Intronic
1055087478 9:72328937-72328959 ATGGGGTGGGGGGAGGGGGAGGG - Intergenic
1055115705 9:72602933-72602955 TTTGGGAGGTGGTAGGAGGAAGG + Intronic
1055385645 9:75759368-75759390 GTGGGGTGGGGGGATGGGGAGGG - Intergenic
1055446984 9:76393950-76393972 AAGGGGATGCGGGAGGAGGAAGG + Intronic
1055533311 9:77210142-77210164 AGAGGGAGGTGGGGGGAGGAAGG - Intronic
1055581446 9:77711066-77711088 AGGAGGAGGGGGGATGGGGAGGG - Intergenic
1055585181 9:77751572-77751594 GTGGGTAGGTGGGCTGGGGATGG + Intronic
1056079095 9:83072242-83072264 ATGGGCAGAAGGTATGAGGATGG - Intergenic
1056177653 9:84051120-84051142 AGAGGGAAGTGGGGTGAGGAAGG - Intergenic
1056223009 9:84468348-84468370 ATGGGGAGGTGGGAAGGGGAGGG + Intergenic
1056578231 9:87871910-87871932 ATGTTGAAGTGGGATGAGGCTGG - Intergenic
1056788123 9:89606871-89606893 AGGGGGAGGAGGGCCGAGGAGGG - Intergenic
1057073575 9:92121605-92121627 GAGGGGAGTTGGGATGAGGAAGG - Intergenic
1057226665 9:93296475-93296497 AGGGGGAGGAGGGAGAAGGAAGG - Intronic
1057231547 9:93324535-93324557 ATGGGGAGGCTGGAGGGGGATGG - Intronic
1057236542 9:93366082-93366104 ATGGGGAGGCTGGAGGGGGATGG + Intergenic
1057498099 9:95575866-95575888 GTGGGGAGATGAGTTGAGGAAGG + Intergenic
1057757397 9:97848960-97848982 ACGGGGAGGTGGGAAGCAGAAGG + Intergenic
1057951483 9:99372365-99372387 ATGAGTAGGTGGGATGGGGGTGG + Intergenic
1058049448 9:100392195-100392217 AGGGGGAAGGGGGATGGGGAGGG - Intergenic
1058149192 9:101445327-101445349 ATGAGGAGGAGAGATGAGAAAGG - Intergenic
1058442130 9:105019196-105019218 TTGGGGAAGTGGGTGGAGGAAGG - Intergenic
1058467166 9:105240886-105240908 TTGGGATGCTGGGATGAGGAAGG - Intergenic
1058559615 9:106212186-106212208 GTGGGGAGGTGGGAGGGGGGAGG - Intergenic
1058961424 9:109995900-109995922 ATGGAGAGGAAGGATGAGGCAGG + Intronic
1058998955 9:110328351-110328373 TTGGGGGGATGGGATGAGGAAGG + Intronic
1059354208 9:113686998-113687020 GTAGGGAGGAGGGAAGAGGAAGG + Intergenic
1059695998 9:116731102-116731124 GTGGGGAGCTGAGATGGGGAGGG - Intronic
1060149026 9:121275599-121275621 GAGGGGAGGTGGGAGGGGGATGG - Intronic
1060207032 9:121688165-121688187 ATGAGGAGGTGGGAAAATGAAGG - Intronic
1060281307 9:122217338-122217360 ATTGGGTGGTGGAAGGAGGAAGG - Intronic
1060449213 9:123721420-123721442 ATGGGGAGGTGGGACAGGAATGG - Intronic
1060523391 9:124307364-124307386 CTTGGGAGGTGGGATTGGGATGG + Intronic
1060597464 9:124856897-124856919 ATGGGTAGGTAGGAGCAGGATGG - Intronic
1060650982 9:125326806-125326828 TTGGGCAGCTGGGAGGAGGATGG - Intronic
1060686804 9:125622139-125622161 ATGGGGAGATGGGGAGAGGCTGG + Intronic
1060795247 9:126508612-126508634 ATGGGAGGGTTGGAGGAGGAGGG - Intergenic
1060816897 9:126639692-126639714 CTGGGGAGGGGGGCAGAGGAGGG + Intronic
1060919460 9:127409522-127409544 ATGGGGAGGTGGGAGGTGATGGG + Intergenic
1060940606 9:127541012-127541034 ATGGGGAGGTGGGGGAAAGAGGG + Intronic
1061086898 9:128404788-128404810 AAGGGGAGGAGGGATGGGGGAGG + Intergenic
1061244773 9:129395854-129395876 ATGAGAAGGTGGAAGGAGGATGG + Intergenic
1061246144 9:129402114-129402136 GTGGGGAGGAGGGAGGAGGGAGG - Intergenic
1061279124 9:129586948-129586970 GTGGGGAGGAGGGAAGAGGGGGG - Intergenic
1061370146 9:130193363-130193385 ATGGGAAAGTGGGATGGGGTGGG + Intronic
1061428667 9:130517408-130517430 TTGGGGAGGGGAGGTGAGGAGGG + Intergenic
1061517628 9:131098616-131098638 TTGGGGAGGTGGGTTGGGGGAGG + Intronic
1061637473 9:131922022-131922044 ATGGGGAGGGGGGAGGGGGAGGG + Intronic
1061726511 9:132584854-132584876 ATGGAGAAGGGGGAGGAGGAAGG + Intronic
1061796827 9:133090520-133090542 TTGGGGTGGGGGGAAGAGGAAGG - Intergenic
1061912910 9:133734305-133734327 ATGGGGAAGTGGCAAGAGGAAGG - Intronic
1061961240 9:133990422-133990444 TTGGGAAGATGGGAAGAGGAGGG - Intronic
1061996792 9:134190180-134190202 GCGGGGAGGTGGGAGGTGGACGG - Intergenic
1062018366 9:134303813-134303835 ATGGGGAGGGGGGCTGAGGACGG - Intergenic
1062159037 9:135069602-135069624 GGGGAGAGGTGGGAGGAGGAGGG + Intergenic
1062169899 9:135129193-135129215 CTGGGGAAGTGGGGTGGGGATGG + Intergenic
1062283064 9:135760445-135760467 TTGGGGAGATGGGAGAAGGAGGG + Intronic
1062372969 9:136249535-136249557 CTGGGGAGCTGGGAAAAGGACGG + Intergenic
1062469715 9:136697032-136697054 AGGGGGAGGGGGGAGGAGGAGGG - Intergenic
1062469726 9:136697051-136697073 AGGGGGAGGGGGGAGGAGGAGGG - Intergenic
1062469747 9:136697088-136697110 AGGGGGAGGGGGAAGGAGGAGGG - Intergenic
1062697930 9:137884891-137884913 AGAGGGAGGCGGGAAGAGGAGGG - Intronic
1203695907 Un_GL000214v1:96717-96739 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1203741777 Un_GL000218v1:9723-9745 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1203363128 Un_KI270442v1:235343-235365 ATGGGGAGGTGGTGTGGGGTGGG - Intergenic
1203701966 Un_KI270742v1:4313-4335 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1203640366 Un_KI270751v1:7346-7368 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1185575568 X:1169289-1169311 AGGAGGAGGAGGGAGGAGGAGGG + Intergenic
1185796716 X:2971851-2971873 ATGGGGAGTTGGAAAGGGGACGG + Intergenic
1185871323 X:3667389-3667411 TGGAGGAGATGGGATGAGGATGG - Intronic
1185928742 X:4176308-4176330 ATGGGAATGGGGGATGAGGGAGG + Intergenic
1186147405 X:6638652-6638674 ATGGGGTGGTGGGAGGGGGGAGG + Intergenic
1186214436 X:7283759-7283781 ATGGTGGTGGGGGATGAGGAAGG + Intronic
1186401594 X:9265348-9265370 TTGGGGAGGTGGGGGGATGACGG + Intergenic
1186410652 X:9342411-9342433 ATGGGGAGGGGAGAGGTGGAGGG - Intergenic
1186436603 X:9548319-9548341 ATGGGGTGGTGGGATAAGGATGG - Intronic
1186506589 X:10098306-10098328 CTGGGGAGGGGGGAGGGGGAAGG - Intronic
1186562437 X:10626860-10626882 ATGTGGTATTGGGATGAGGAGGG + Intronic
1186641329 X:11458925-11458947 AAGAGGAGGTGGGATGGGGTGGG + Intronic
1186681958 X:11884061-11884083 ATTCAGAGGTGGGATGAGGTAGG + Intergenic
1187068008 X:15859940-15859962 ATGGGGTGGGGGGAGGGGGAGGG - Intergenic
1187127329 X:16466341-16466363 ATGGGGCGGTGGGGGGCGGAGGG - Intergenic
1187433563 X:19246854-19246876 ATGGAGAGGTGGTCTGATGATGG - Intergenic
1187591439 X:20721551-20721573 AGGAGGAGGAGGGAGGAGGAAGG - Intergenic
1187674203 X:21699719-21699741 CTGGGGAGGTGAGATGAAGCAGG - Intergenic
1187712319 X:22066742-22066764 ATGAGGAGGTGAGAGAAGGAGGG - Intronic
1187841170 X:23490065-23490087 AAGGGGAGGGGGGAGGGGGAGGG + Intergenic
1187877483 X:23816291-23816313 CTGAGGAGTTGGGAAGAGGAAGG - Intergenic
1187943404 X:24403119-24403141 ATGGGGAGGGGGCAGGGGGAGGG - Intergenic
1188040968 X:25369545-25369567 ATGGGGAGATGGGTGGAGCAAGG + Intergenic
1188316112 X:28675695-28675717 ATATGGGGGTGGGATGAGGAAGG + Intronic
1188508201 X:30906251-30906273 AAGGGGAGGTGGGGTGGGGGGGG - Intronic
1188862967 X:35279408-35279430 ATGTGGAGGTAGTCTGAGGAGGG + Intergenic
1189135175 X:38541620-38541642 GTGGGGTGGGGGGATGGGGAGGG + Intronic
1189234886 X:39479197-39479219 TGGTGCAGGTGGGATGAGGATGG + Intergenic
1189286099 X:39853580-39853602 ATGGAAAGGGGGGAAGAGGAGGG + Intergenic
1190066632 X:47245866-47245888 GTGTGGAGGAGGGAGGAGGAAGG - Intronic
1190066900 X:47247732-47247754 GTGGGGAGGTGGAATCAGAAAGG - Intronic
1190154026 X:47973258-47973280 ATGGGGAGTTGGGTGGAGGTGGG - Intronic
1190166860 X:48080455-48080477 ATGGGAAGTAGGGATGAGCAGGG - Intergenic
1190332280 X:49243199-49243221 GTGGGGAGGGGTGAGGAGGAAGG + Intronic
1190403809 X:50066011-50066033 GTGGGGAGGGGGGAGGGGGAAGG + Intronic
1190522759 X:51297015-51297037 ATGGGGTGGGGGGAGGAGGGGGG + Intergenic
1190681461 X:52830338-52830360 AGGGGGAGGGGGGAGAAGGAGGG - Intergenic
1190879064 X:54479811-54479833 AGGGGCAGGTGGGAAGAGGTGGG - Intronic
1190909135 X:54756043-54756065 TTGGGGTGGTGGGAAGTGGATGG + Intronic
1191113242 X:56824598-56824620 ATGGGGTGGGGGCATGAGGGAGG + Intergenic
1191184010 X:57591470-57591492 GCGGGGAGGTGGGAAGGGGAAGG + Intergenic
1191188132 X:57635254-57635276 ATGGGGTGGTGGGAAGGGGGAGG + Intergenic
1191629525 X:63306863-63306885 ATGGGGTGGTGGGAGGGGGGAGG + Intergenic
1191756499 X:64598222-64598244 GTGGGGTGGGGGGATGGGGAGGG + Intergenic
1191794540 X:65006558-65006580 ATGGGGTGGTGGGAGGGGGGAGG + Intronic
1191880639 X:65841205-65841227 ATGGGTATGAGGGAAGAGGATGG + Intergenic
1191913590 X:66178086-66178108 ATGGGGTGGGGGGATGTGGGAGG - Intronic
1191937758 X:66443168-66443190 AGGGGGAGGAGGGAGTAGGAGGG - Intergenic
1192050776 X:67722072-67722094 ATGGGGAGGGGGAATGAAGAAGG - Intronic
1192058029 X:67793116-67793138 CTGGGGAGGGAGCATGAGGAAGG + Intergenic
1192112315 X:68377572-68377594 GTGGGGTGGGGGGAGGAGGAGGG - Intronic
1192197837 X:69041785-69041807 AAGAGGAGGTGGGAGCAGGAAGG - Intergenic
1192287130 X:69750164-69750186 ATGGGGTGGGGGGAGGGGGAGGG - Intronic
1192360064 X:70433810-70433832 AGGGGGAGATGGGAGGAGGTGGG + Intergenic
1192764180 X:74125642-74125664 ATGGTGATGTAGGATGTGGAAGG + Intergenic
1192808328 X:74529092-74529114 ATGGGGTGGTGGGAGGGGGAAGG - Intronic
1192904705 X:75538673-75538695 ATGGGAAGGTGGGAAGGAGAAGG - Intergenic
1192925415 X:75750211-75750233 ATGGGGATGGAGGATGGGGAGGG - Intergenic
1193037843 X:76972753-76972775 ATGGGGAGGGGGGCTGTGGGAGG + Intergenic
1193290325 X:79765738-79765760 GTGGGGAGGTGGGAGGGGGGAGG - Intergenic
1193315520 X:80060689-80060711 ATGGGGTGGAGGGATGGGGGAGG - Intergenic
1193632359 X:83905538-83905560 CTGGTAAGGTGGGATGAGAATGG - Intergenic
1193657194 X:84212731-84212753 ATGGGGTGGGGGGATGGGGGAGG - Intergenic
1193667515 X:84340104-84340126 AAGGGAAGGTGGGAGGTGGAAGG + Intronic
1193859789 X:86651223-86651245 GGAGAGAGGTGGGATGAGGATGG + Intronic
1194119463 X:89942998-89943020 ATGGGGAGCTGGAAGGTGGAGGG - Intergenic
1194513333 X:94821623-94821645 GTGGGGAAGTGGTATGTGGATGG - Intergenic
1194763076 X:97816994-97817016 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1194972634 X:100360960-100360982 TTTGGGAAGGGGGATGAGGAGGG + Intronic
1195004222 X:100670677-100670699 ATGGGGACCAGGGATGAGGTGGG + Intronic
1195013469 X:100755574-100755596 ATGGGGAAGAGGTATGTGGATGG - Intergenic
1195289072 X:103414195-103414217 ATGGCGATGTGGCAGGAGGAGGG + Intergenic
1195315565 X:103674534-103674556 GTGGGGAGGGGGGTGGAGGAGGG - Intergenic
1195403965 X:104492537-104492559 AGTGGGAGCTGGGATAAGGAGGG - Intergenic
1195413517 X:104595241-104595263 ATGTTGAGGTGGGAAGGGGAAGG + Intronic
1195503274 X:105628025-105628047 GGGAGGAGGTGGGATGAGGTGGG + Intronic
1195688488 X:107605383-107605405 TTGGGGAGGTGGGAGGAACAGGG - Intergenic
1195696221 X:107669589-107669611 AGGGGGATGGGGGAGGAGGAAGG - Intergenic
1195980294 X:110570163-110570185 CTGGGGTGGGGGGAGGAGGAAGG - Intergenic
1196480405 X:116141377-116141399 ATGGTGAGGTGGGGGGGGGAGGG - Intergenic
1196812673 X:119641128-119641150 AAGGGGAAGTGGAATGAGGGGGG + Intronic
1196923397 X:120607787-120607809 TTGGGGAAGTGGGGGGAGGAAGG - Intronic
1196995760 X:121381897-121381919 CTGGGGTGGGGGGCTGAGGAAGG - Intergenic
1197116364 X:122838265-122838287 ATGGGGTGGGGGGAGGGGGAGGG + Intergenic
1197311657 X:124912563-124912585 ATGGGGAGCTGGGGTGGGGTTGG + Intronic
1197591956 X:128420012-128420034 ATGGGGAAGAGGTATGTGGATGG + Intergenic
1197643723 X:128994378-128994400 GTGTGGAAGGGGGATGAGGAGGG + Intergenic
1197732435 X:129822449-129822471 GTCGGGGGGTGGGGTGAGGAGGG + Intronic
1197750041 X:129957750-129957772 ATCGAGGGGTGGGAGGAGGAGGG + Intergenic
1197821722 X:130547894-130547916 ACTGGGAGGTGGCATGAAGATGG + Intergenic
1198434590 X:136603833-136603855 ATGGTGAGGTGGACAGAGGAGGG - Intergenic
1198660461 X:138962845-138962867 ATGGGGTTGTGGGACGGGGAGGG + Intronic
1199693367 X:150326148-150326170 ATGTGGTGGTGGAAGGAGGAGGG - Intergenic
1199712044 X:150476565-150476587 ATGGGGAGGAGGGATGTGGATGG + Intronic
1199779684 X:151046729-151046751 ATGGGGATTTGGGTTGGGGAAGG - Intergenic
1200136723 X:153878864-153878886 GTGGGGAGATGGGATGGGGCTGG - Intronic
1200368320 X:155692141-155692163 GTGGGGAGGAGGGATAAAGAGGG + Intergenic
1200389589 X:155930852-155930874 GTGGGGTGGTGGGAGGGGGAAGG - Intronic
1200472336 Y:3600555-3600577 ATGGGGAGCTGGAAGGTGGAGGG - Intergenic
1200792778 Y:7314273-7314295 TGGAGGAGATGGGATGAGGATGG + Intergenic
1200835360 Y:7726744-7726766 AGGAGAAGGTGGGAAGAGGAGGG + Intergenic
1201155309 Y:11127177-11127199 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1201237610 Y:11926148-11926170 ATGGGGAGGTGACACCAGGAAGG - Intergenic
1201454564 Y:14155481-14155503 ATGGGGTGGGGGGAGGAGGGAGG + Intergenic
1201486138 Y:14496469-14496491 AAGAGGAGGCAGGATGAGGAAGG - Intergenic
1201634301 Y:16105092-16105114 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1201678929 Y:16620560-16620582 ATGGGGAGGATGGGTGAGAAAGG - Intergenic
1201751498 Y:17436650-17436672 ATGGGGAGATGGAAAGGGGATGG + Intergenic
1202055690 Y:20827295-20827317 GTGGGGTGGGGGGATGGGGAGGG + Intergenic
1202200233 Y:22339755-22339777 GTGGGGTGGTGGGAGGGGGAAGG - Intronic