ID: 909686136

View in Genome Browser
Species Human (GRCh38)
Location 1:78351094-78351116
Sequence TTAGCAGTCCTCATGCATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 88}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909686136_909686143 13 Left 909686136 1:78351094-78351116 CCACCATGCATGAGGACTGCTAA 0: 1
1: 0
2: 0
3: 8
4: 88
Right 909686143 1:78351130-78351152 GAACATAAAGAGAGGGCAGAAGG 0: 1
1: 0
2: 5
3: 34
4: 493
909686136_909686142 6 Left 909686136 1:78351094-78351116 CCACCATGCATGAGGACTGCTAA 0: 1
1: 0
2: 0
3: 8
4: 88
Right 909686142 1:78351123-78351145 CTGTGCAGAACATAAAGAGAGGG 0: 1
1: 0
2: 1
3: 18
4: 288
909686136_909686141 5 Left 909686136 1:78351094-78351116 CCACCATGCATGAGGACTGCTAA 0: 1
1: 0
2: 0
3: 8
4: 88
Right 909686141 1:78351122-78351144 GCTGTGCAGAACATAAAGAGAGG 0: 1
1: 0
2: 0
3: 19
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909686136 Original CRISPR TTAGCAGTCCTCATGCATGG TGG (reversed) Intronic
901729232 1:11266807-11266829 TGGGCTGTCCACATGCATGGTGG + Intergenic
907590222 1:55659612-55659634 TTAGCATTTCACATGCAAGGAGG - Intergenic
907940597 1:59083572-59083594 TTTGCAGGCCTCAGGCATGACGG + Intergenic
908811032 1:67982515-67982537 TTAACAGTCCTCATTGATGCTGG + Intergenic
909686136 1:78351094-78351116 TTAGCAGTCCTCATGCATGGTGG - Intronic
914972704 1:152325267-152325289 ATAGCAGGCCCCATGCAGGGAGG + Intergenic
915162264 1:153929084-153929106 TTGGCAGCCCTCATGCATCCTGG - Intergenic
916922926 1:169487478-169487500 TTAGCAGTCCTCAAACATTTTGG - Intergenic
920653326 1:207854895-207854917 TTAGCTGTCCTCATCCATCAGGG - Intergenic
924704404 1:246488001-246488023 TTAGCATTTCCTATGCATGGTGG + Intronic
1062863381 10:828126-828148 TTAGCTGTCCTGAGGCATGTGGG - Intronic
1063259150 10:4365312-4365334 ATAGCAATCCTCATGCTTGATGG + Intergenic
1068856007 10:61798163-61798185 TCATCATTCCTCATGCCTGGAGG - Intergenic
1074437431 10:113445989-113446011 TTCCCAGCCCTCATGCATGTTGG - Intergenic
1082018019 11:47506788-47506810 ATAGCAGGCCTCATGCAAGAAGG + Intronic
1083813932 11:65121499-65121521 GTAGCAGGCCGCATGCTTGGAGG - Exonic
1084961439 11:72718752-72718774 GCAGCAGACCTCATGCCTGGGGG + Intronic
1090346724 11:126077454-126077476 TAAGCCATCCTCATGCATGGAGG - Intergenic
1092867034 12:12771313-12771335 TTAGCAGGTGTCATGCCTGGTGG + Intronic
1096078502 12:48818925-48818947 GTAGGAGTCGTCATACATGGGGG - Exonic
1101842193 12:108335904-108335926 TTAGCAATCCCCCAGCATGGAGG - Intronic
1121812068 14:96900287-96900309 TTAACAATCCTCTGGCATGGGGG + Intronic
1129951776 15:79598331-79598353 TTAGCAATGCTCATGAATGGTGG + Intergenic
1137239004 16:46638946-46638968 TTGGGAGTCATCAGGCATGGAGG - Intergenic
1143356294 17:6331231-6331253 TTAGCTGGCCTTAGGCATGGTGG + Intergenic
1152425689 17:80217424-80217446 TTAGCAGGTCTCATACTTGGTGG + Intronic
1153019200 18:611409-611431 TTAGGAGGGCTCAGGCATGGTGG + Intronic
1155386717 18:25285842-25285864 GTGGCAGTCCTGATACATGGAGG - Intronic
1156720215 18:40060716-40060738 TTAGCAGTCTTCAGGGAAGGTGG + Intergenic
1156803311 18:41145232-41145254 TTAGCACTCCTACTGCATGAAGG + Intergenic
1156992998 18:43432730-43432752 TTAGTATTCCTCAAGCAAGGTGG - Intergenic
1157939593 18:51912927-51912949 TTAGGGCTCCTCATTCATGGTGG - Intergenic
1159128594 18:64254179-64254201 TCAGCAGTCTTCATGCACGAAGG - Intergenic
1159938840 18:74390077-74390099 GTAGCAGGCCGCATGCTTGGAGG - Intergenic
1161506321 19:4645803-4645825 TTGGCAGGCCCCATGCATGGGGG - Intronic
925087009 2:1116420-1116442 TTAGGGGTGCTCTTGCATGGGGG + Intronic
925295793 2:2776186-2776208 ACAGAAGTCATCATGCATGGAGG + Intergenic
926427973 2:12756946-12756968 TTCGCAGTTCTCATCCATGAAGG + Intergenic
931055678 2:58467839-58467861 TTAGCATTGCTCTTGCAAGGTGG + Intergenic
932317527 2:70795862-70795884 TTAGCCGCCCACAGGCATGGAGG - Intergenic
944909637 2:204297205-204297227 TTAGCAGTGATCTTGCATGTTGG + Intergenic
945358074 2:208862085-208862107 TTAGCAGTGCATATGCATGGAGG + Intergenic
1174116691 20:48231121-48231143 TGAGCAGTCATCATGCCTGGAGG - Intergenic
1177033177 21:16008680-16008702 TTAGGATTTCTCATGCAAGGTGG + Intergenic
1178313983 21:31554036-31554058 TTAGCAGCTCTCAGGCAAGGTGG + Intronic
1179236794 21:39554575-39554597 TTAGCTGTCCTCAGGCCTTGTGG + Intergenic
1183739552 22:39662326-39662348 ATTGCAGTCCTCATGCCCGGGGG - Exonic
950461170 3:13122974-13122996 TCAGCACACCTCATGCAGGGAGG - Intergenic
953637367 3:44674456-44674478 TTGGCAGTCTTTATGCATGCAGG + Intergenic
954283826 3:49603520-49603542 TCAGCACTCCTCATACATGAGGG - Intronic
954364714 3:50139698-50139720 CTAGGAGTGCTCATTCATGGGGG + Intergenic
955058036 3:55473699-55473721 GTAGCAGGCCTGATGGATGGAGG - Intronic
960811191 3:121628953-121628975 CTAGCAGTCCTCAAGCAAGTGGG + Exonic
961639525 3:128356408-128356430 TAATCAGTTCTCATGCATTGTGG - Intronic
962060105 3:131917098-131917120 TCTGCAATCCACATGCATGGAGG + Intronic
962823555 3:139077067-139077089 ATAGCAGTGCTCATCAATGGAGG + Intronic
966141308 3:176759548-176759570 TTAGTAGTTCTTAAGCATGGTGG - Intergenic
967880900 3:194300533-194300555 TGAGCAGGCCTCAGGCAAGGAGG + Intergenic
970939353 4:21613342-21613364 TTGAATGTCCTCATGCATGGTGG - Intronic
972688725 4:41375678-41375700 TGAGCAGTCCCCAGGCATGTGGG + Intronic
976504318 4:85829416-85829438 TTGGCATTCCACATGCATGTAGG - Intronic
977140266 4:93362445-93362467 TTGGCAGGTCTCATGCTTGGGGG + Intronic
977844282 4:101748294-101748316 TTTGCAATGCTCATGGATGGAGG + Intronic
980008153 4:127565096-127565118 TTAGCAGTTCTCAAGAATGTTGG - Intergenic
982439874 4:155422887-155422909 TGGACTGTCCTCATGCATGGAGG + Intergenic
984893250 4:184512393-184512415 TTTGCAGTCCTCCTGAATGCAGG - Intergenic
986171215 5:5316323-5316345 TTGGAAGTCCTGGTGCATGGTGG - Intronic
987193926 5:15505968-15505990 TAAGCACTTATCATGCATGGTGG + Intronic
989243206 5:39223629-39223651 TTAGAATTACTCTTGCATGGGGG - Intronic
997211729 5:132080848-132080870 TCAGGAGACCTCATGCCTGGAGG - Intergenic
997475906 5:134142361-134142383 GTGGCAGTCCTCAGGCCTGGTGG - Intronic
1003992097 6:11496410-11496432 TTGACAGCCCTCATACATGGAGG - Intergenic
1004951511 6:20677701-20677723 TTAGCTCTCGCCATGCATGGGGG - Intronic
1005178406 6:23074607-23074629 TTAGCATTCCTGAGGCATTGTGG + Intergenic
1014748417 6:125227578-125227600 TTAGTATCCCACATGCATGGAGG - Intronic
1015454509 6:133410845-133410867 TTTGTAGTCTTCAGGCATGGGGG + Intronic
1016226427 6:141744870-141744892 TTTGTGTTCCTCATGCATGGAGG - Intergenic
1017403535 6:154092117-154092139 TTAACAGACCTCATGCTTGTTGG + Intronic
1017669015 6:156752399-156752421 TTTGCAGTCCTCCTGCCTGGTGG + Intergenic
1021222445 7:17989670-17989692 TTACCAGTGCTCAGGCATGGTGG - Intergenic
1027643469 7:80766943-80766965 TGAGCTGTCCGCAGGCATGGTGG - Intronic
1027854359 7:83489854-83489876 TTGACATTCCTCTTGCATGGTGG - Intronic
1033008221 7:137590555-137590577 TTAGCATTCCTCCTGCACTGTGG - Intronic
1033462204 7:141556874-141556896 TTATTAGTCTTCCTGCATGGAGG + Intronic
1034218339 7:149424503-149424525 TTAGAAGTCCTCATACTGGGTGG + Intergenic
1036275476 8:7348185-7348207 ATAGCTGTCCTCAGGCCTGGAGG - Intergenic
1036345878 8:7962173-7962195 ATAGCTGTCCTCAGGCCTGGAGG + Intergenic
1036841206 8:12122926-12122948 ATAGCTGTCCTCAGGCCTGGAGG + Intergenic
1036863012 8:12369178-12369200 ATAGCTGTCCTCAGGCCTGGAGG + Intergenic
1037492580 8:19410148-19410170 TGAGCAGTCCTGATGCTTGCAGG - Intronic
1040654834 8:49495472-49495494 TTAGTAGTCCAAATGCAAGGTGG - Intergenic
1049563620 8:143325824-143325846 TTAGCCCTCCTCCTCCATGGCGG - Intronic
1050981833 9:12028787-12028809 TTAGCAGTCTTCATGAGTGCTGG - Intergenic
1189678950 X:43494146-43494168 TTAGCACTACTCAAACATGGGGG + Intergenic
1192589260 X:72346420-72346442 GAAGCAGTGCTCCTGCATGGTGG - Intronic
1196176593 X:112645234-112645256 TTACCAATCCTCATTAATGGAGG + Intronic
1202604984 Y:26631712-26631734 TTAGCAGTGCCCATGCCTGGAGG - Intergenic