ID: 909695254

View in Genome Browser
Species Human (GRCh38)
Location 1:78461333-78461355
Sequence CCTGATAAACAACTACAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 1, 2: 16, 3: 75, 4: 267}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909695254_909695261 6 Left 909695254 1:78461333-78461355 CCTTGCTGTAGTTGTTTATCAGG 0: 1
1: 1
2: 16
3: 75
4: 267
Right 909695261 1:78461362-78461384 AACCTTTGGGTAGAGACTATGGG 0: 1
1: 5
2: 71
3: 246
4: 651
909695254_909695257 -8 Left 909695254 1:78461333-78461355 CCTTGCTGTAGTTGTTTATCAGG 0: 1
1: 1
2: 16
3: 75
4: 267
Right 909695257 1:78461348-78461370 TTATCAGGCCTAGGAACCTTTGG 0: 1
1: 0
2: 13
3: 102
4: 306
909695254_909695264 16 Left 909695254 1:78461333-78461355 CCTTGCTGTAGTTGTTTATCAGG 0: 1
1: 1
2: 16
3: 75
4: 267
Right 909695264 1:78461372-78461394 TAGAGACTATGGGGATTTTTAGG 0: 1
1: 2
2: 18
3: 164
4: 467
909695254_909695262 7 Left 909695254 1:78461333-78461355 CCTTGCTGTAGTTGTTTATCAGG 0: 1
1: 1
2: 16
3: 75
4: 267
Right 909695262 1:78461363-78461385 ACCTTTGGGTAGAGACTATGGGG No data
909695254_909695258 -7 Left 909695254 1:78461333-78461355 CCTTGCTGTAGTTGTTTATCAGG 0: 1
1: 1
2: 16
3: 75
4: 267
Right 909695258 1:78461349-78461371 TATCAGGCCTAGGAACCTTTGGG 0: 2
1: 1
2: 27
3: 272
4: 951
909695254_909695260 5 Left 909695254 1:78461333-78461355 CCTTGCTGTAGTTGTTTATCAGG 0: 1
1: 1
2: 16
3: 75
4: 267
Right 909695260 1:78461361-78461383 GAACCTTTGGGTAGAGACTATGG 0: 1
1: 7
2: 74
3: 219
4: 597

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909695254 Original CRISPR CCTGATAAACAACTACAGCA AGG (reversed) Intronic
900107603 1:991082-991104 ACTAATAAACAGGTACAGCAAGG - Intergenic
901128616 1:6947883-6947905 ACTGATAAACAAGTTCACCAAGG - Intronic
901583997 1:10271480-10271502 CCTGATAAAGAACAATAACATGG - Exonic
904103136 1:28051257-28051279 ACTGATAAACAAGTTCAGCAAGG + Intronic
904506547 1:30960526-30960548 ACTAATAAACAACTACAGCGAGG + Intronic
905026473 1:34853687-34853709 TATTATAAACAACTACAGCCAGG + Exonic
907042293 1:51273868-51273890 CATGATAAACACCAATAGCAGGG - Intergenic
907949844 1:59171713-59171735 CCTGAGAAACTACAACAGAACGG - Intergenic
908547397 1:65175316-65175338 CCTGTTGGAGAACTACAGCAAGG - Intronic
909463209 1:75943079-75943101 GCTGATAAGCAACTTCAGCAAGG - Intergenic
909492801 1:76244309-76244331 GCTGATAAGCAACTTCAGCAAGG - Intronic
909695254 1:78461333-78461355 CCTGATAAACAACTACAGCAAGG - Intronic
909805577 1:79870649-79870671 GCTGATAACCAACTTCAACAAGG + Intergenic
909874313 1:80783477-80783499 TCTGATAAACAACTTCAGCAAGG + Intergenic
909891603 1:81014455-81014477 GCTGATAAGCAACTTCAGCATGG + Intergenic
910168773 1:84355863-84355885 CCAGATAAACAAGGACAGGAGGG + Intronic
910385510 1:86678364-86678386 CCTGATAAACAACTTCAGCAAGG + Intergenic
910671166 1:89774310-89774332 CCTGTCAAGCAACAACAGCATGG + Intronic
911271037 1:95801458-95801480 ACTGTTAAGCAACTTCAGCAAGG + Intergenic
911434243 1:97834856-97834878 ACTTATAAAGAACTTCAGCAGGG - Intronic
911649479 1:100371163-100371185 ACTGATAAACAACTTCAATAAGG - Intronic
911669299 1:100590462-100590484 CCTGACAAAGAAATAAAGCAAGG - Intergenic
912887698 1:113492676-113492698 GCTGATACACAAATTCAGCAAGG + Intronic
913028144 1:114867619-114867641 ACTAATAAGCAATTACAGCAAGG - Intronic
916032590 1:160891105-160891127 TCTCATAAGCAACTCCAGCAAGG + Intergenic
917004647 1:170400051-170400073 ACTGATAAACACCTTCAGTAAGG + Intergenic
917143028 1:171856736-171856758 GCTGATAAACAACTTCATCAAGG - Intronic
917228454 1:172809866-172809888 GCTGATAAACAATGTCAGCAAGG - Intergenic
919274210 1:195391583-195391605 ACTGATAAACAAATTCAGTAAGG - Intergenic
919576831 1:199320737-199320759 GCTGATAAACAACTTCAGTGAGG - Intergenic
921093356 1:211864136-211864158 TCTAATAAACAATTATAGCAAGG - Intergenic
922744088 1:228034336-228034358 ACTGATCAACAACTCCAGCAAGG - Intronic
923023092 1:230180967-230180989 ACTAATAAACAATTACAGCAAGG - Intronic
923709122 1:236371284-236371306 ACGAATAAACAATTACAGCAAGG - Intronic
1065297010 10:24286073-24286095 CCTGATAAACAACTTCACTAAGG - Intronic
1066664584 10:37769902-37769924 GCTGATAAGCAACTTCAGCAAGG + Intergenic
1067320344 10:45213785-45213807 ACTAATAAACAACTACAGCAAGG + Intergenic
1067514294 10:46924051-46924073 CTTAATAAGCAATTACAGCAAGG - Intronic
1067647963 10:48127758-48127780 CTTAATAAGCAATTACAGCAAGG + Intergenic
1067857952 10:49813233-49813255 ACTGATAAACAATTGCAGCAGGG - Intergenic
1068575553 10:58680315-58680337 GCTGATAAGCAGCTTCAGCAAGG + Intronic
1069541885 10:69300903-69300925 ACTAATAAACAATTTCAGCAAGG + Intronic
1071000100 10:80821959-80821981 GCTGATAAACAACTTCAGCAAGG + Intergenic
1071998405 10:91169412-91169434 ACTAATAAGCAATTACAGCAGGG + Intronic
1072364941 10:94699756-94699778 GCTGACAAGCAACTTCAGCAAGG + Intronic
1072597718 10:96890424-96890446 CCTAATAAACAGGTTCAGCAAGG - Intronic
1072872688 10:99137020-99137042 GCTGATAAGCAACTTCAGTAAGG + Intronic
1072876578 10:99179391-99179413 GCTGATAAGCAACTTCAGCAAGG + Intronic
1073997881 10:109337241-109337263 GTTGATAAGCAACTTCAGCAAGG - Intergenic
1074000885 10:109371533-109371555 GCTGATAAGCAACTTCAGCAAGG + Intergenic
1074255796 10:111801434-111801456 CCTGATAAAGAACTACACAGGGG + Intergenic
1074930625 10:118122051-118122073 AGTGAAAAACAAATACAGCATGG - Intergenic
1077780256 11:5319986-5320008 ACTGATAAACAATTTTAGCAAGG + Intronic
1078348846 11:10575922-10575944 CCTGATAACCAATTACAGAGAGG + Exonic
1078644051 11:13122218-13122240 ACTAATAAACAAGTTCAGCAAGG - Intergenic
1084405541 11:68970522-68970544 CTTGAAAAACCACTGCAGCACGG - Intergenic
1085876341 11:80410643-80410665 CCTCATAAATGACTTCAGCAGGG + Intergenic
1085909271 11:80802072-80802094 GCTGATGAGCAACTTCAGCAAGG + Intergenic
1085981105 11:81727053-81727075 TTTAATAAACAACTTCAGCAAGG - Intergenic
1087428177 11:98016639-98016661 GCAGATAAGCAACTTCAGCAAGG + Intergenic
1087438786 11:98156888-98156910 CCTAATAAACAAGTTTAGCAAGG - Intergenic
1088733371 11:112704018-112704040 ACTGATAAACAATTTTAGCATGG + Intergenic
1091342916 11:134833176-134833198 CCTGATAAACAAGTTCATCAAGG + Intergenic
1093324368 12:17756252-17756274 ACTGATAAACAAATTCAGTAAGG - Intergenic
1094274940 12:28663105-28663127 ACTAATAAACAATTATAGCAAGG + Intergenic
1094609927 12:31985129-31985151 CATGATAAACAAGAACAGAAAGG + Exonic
1094672696 12:32586527-32586549 CCTCAGAAACAATTAAAGCATGG + Intronic
1094816868 12:34195853-34195875 GCTGATAAACAACTTCCACATGG + Intergenic
1095100170 12:38173292-38173314 GCTGATAAACAACTTCCACATGG - Intergenic
1095815940 12:46422795-46422817 GCTGATAAGCAACATCAGCAAGG - Intergenic
1097427551 12:59466088-59466110 GCTGATAAGCAACTTCAGCGAGG - Intergenic
1097456085 12:59800198-59800220 GCTGATGAGCAACTTCAGCAAGG + Intergenic
1098039953 12:66343770-66343792 ACTAATAAACAAGTGCAGCAAGG - Exonic
1099026641 12:77472557-77472579 ACTAATAAACAAATACAGTAAGG + Intergenic
1099731913 12:86515411-86515433 ACTTATAAACAAATTCAGCAAGG + Intronic
1100017804 12:90032979-90033001 ACTAATAAACAATTAGAGCATGG - Intergenic
1100793592 12:98156971-98156993 CCTGATATAGAACAAGAGCAAGG - Intergenic
1103592000 12:121998391-121998413 ACTGGTAAACAACTTCAGCAAGG - Intronic
1104470760 12:129027960-129027982 CCTGAGAAGGAAGTACAGCAGGG - Intergenic
1105788631 13:23774760-23774782 ACTGATAAACCAGTTCAGCAGGG - Intronic
1107705488 13:43099248-43099270 CCTAATAAATAAGTTCAGCAAGG - Intronic
1108296916 13:49030641-49030663 ACTAATAAACAAGTTCAGCAAGG + Intronic
1109212761 13:59553372-59553394 ACTGATAAACAAATTCAGTAAGG + Intergenic
1109244317 13:59934901-59934923 CCTGGTGAACATGTACAGCAAGG - Intronic
1109366900 13:61367567-61367589 CCTGGTAAGCAACTTCAACAAGG + Intergenic
1109679902 13:65737281-65737303 ACTGATAAACAAATTCAGTAAGG + Intergenic
1110099525 13:71579862-71579884 CCTGGTTAACACTTACAGCATGG - Intronic
1110610663 13:77484090-77484112 TCTGATGAACATCTTCAGCAAGG - Intergenic
1110767331 13:79295830-79295852 CATGAGAAGCATCTACAGCAAGG + Intergenic
1110907836 13:80915513-80915535 GCTGATAAACAACCTCAGCAAGG + Intergenic
1112179409 13:97062698-97062720 CCTATTAAACAACCACAGGAAGG + Intergenic
1112403375 13:99095917-99095939 GCTAATAAACAAGTTCAGCAAGG + Intergenic
1113342803 13:109443349-109443371 GCTGATAAGCAACTTTAGCAAGG - Intergenic
1113504154 13:110801670-110801692 ACTGAGAAACAAATGCAGCAAGG - Intergenic
1114706253 14:24729482-24729504 CCTGAGACACAGCTAAAGCAGGG + Intergenic
1114765536 14:25366632-25366654 GCTGATAAGCAACTTCAGCAAGG - Intergenic
1114775986 14:25482048-25482070 CCTCATAAACAACTGAAGCCAGG - Intergenic
1115188924 14:30725546-30725568 GCTGATAAACAACTTCAGCAAGG - Intronic
1115670912 14:35610763-35610785 GCTAATAAACAAGTTCAGCAAGG + Intronic
1116305918 14:43256010-43256032 GCTGATAAGCAACTTCAGCAAGG + Intergenic
1117818987 14:59628978-59629000 CCTGACAAACAACTATGGCTTGG - Intronic
1118268439 14:64318129-64318151 ACTAATAAACAATTACAGCAAGG + Intronic
1118582726 14:67319492-67319514 CAAGTTATACAACTACAGCAGGG + Intronic
1121934344 14:98003358-98003380 GCTGATAAGCAACTTCAGCAAGG + Intergenic
1123413344 15:20077354-20077376 GCTAATAAACAAGTTCAGCAAGG - Intergenic
1123522686 15:21084465-21084487 GCTAATAAACAAGTTCAGCAAGG - Intergenic
1126213712 15:46130514-46130536 TGTGATAAACAACTTCAGCAAGG - Intergenic
1126270025 15:46804857-46804879 CCTGATAAATGACTTCAGTAAGG + Intergenic
1126284186 15:46992648-46992670 ACTGATAACCAAGTTCAGCAAGG - Intergenic
1130139333 15:81210706-81210728 ACTGATAAACAACTTTAGCAAGG - Intronic
1130671832 15:85919705-85919727 CCTGATAAACCACCACAGCTGGG - Intergenic
1130922648 15:88361336-88361358 GCTGATAAGCAACTTCAGCAAGG + Intergenic
1131988842 15:98072492-98072514 CCTGATAAATGACTTCATCAAGG - Intergenic
1134123399 16:11600287-11600309 CCTCCTAAATAACTACATCATGG + Intronic
1137874762 16:51985480-51985502 ACTGATAAAAAATGACAGCAAGG + Intergenic
1139609480 16:68045206-68045228 GCTAATAAACAAGTTCAGCAAGG - Intronic
1145096180 17:20029374-20029396 ACTGATAAACAAGTTCAGCAAGG - Intronic
1145778542 17:27546312-27546334 GCTCATATTCAACTACAGCATGG - Intronic
1148069496 17:44899757-44899779 CCTGATAAACCAGAACAGGAGGG - Exonic
1148402802 17:47382218-47382240 GCTGATAAACAACTTCAGCAAGG - Intronic
1149141987 17:53442066-53442088 TCTGATAAACAACTTCAGCAAGG + Intergenic
1149194754 17:54106143-54106165 ACTGATAAACGATTATAGCAAGG + Intergenic
1149929339 17:60735181-60735203 ATTGATAAGCAATTACAGCAAGG - Intronic
1149940603 17:60861353-60861375 TTTGTTAAACAACTCCAGCAAGG - Intronic
1149951155 17:60987692-60987714 ACTGATAAACAAATTCAGTAAGG - Intronic
1150190027 17:63228792-63228814 GCTGATAAACAACTTCAGCAAGG - Intronic
1150865511 17:68845175-68845197 CCTGATAAGCAACTTCAGCAAGG + Intergenic
1152323200 17:79620700-79620722 CCTGAGAAATACCTACAGGACGG - Intergenic
1153208794 18:2735556-2735578 GCTGATAAACGACTTCAGTAGGG + Intronic
1155488757 18:26376542-26376564 ACTAATAAACAAGTTCAGCAAGG - Intronic
1155529095 18:26747504-26747526 ACAGATAAACAACTACAACCAGG - Intergenic
1156594500 18:38532591-38532613 ACTAATAAACAATTATAGCAAGG - Intergenic
1158611277 18:58942811-58942833 CCTGTTAAACAAATACTGCTGGG - Intronic
1158771490 18:60522686-60522708 GCTGATAAGCAACTTCAGCAAGG - Intergenic
1158882776 18:61796912-61796934 CCTGATGAACATCTAAATCAGGG + Intergenic
1159515989 18:69458664-69458686 TCTGATAAACAATTTTAGCAAGG + Intronic
1162250763 19:9441430-9441452 ACTGATAAACAAGTTCAACAAGG - Intergenic
926287268 2:11499289-11499311 CCTGGGAAACAGCAACAGCAAGG + Intergenic
926970243 2:18460069-18460091 GCTGATAAGCAACTTCAGCAAGG - Intergenic
927802483 2:26113872-26113894 ACTAATAAACAAGTTCAGCAAGG + Intronic
928050106 2:27983815-27983837 ACTAATAAACAGCTTCAGCAAGG - Intronic
929725828 2:44426467-44426489 CCTGATAAATGACTTCAGTAAGG + Intronic
931031403 2:58178861-58178883 GCTGATAAGCAACATCAGCAAGG + Intronic
931097193 2:58954549-58954571 CCTGAAAAACAAGTGCATCATGG - Intergenic
932280851 2:70490820-70490842 CCAGATAAACAAAAAAAGCATGG - Intronic
933115093 2:78458571-78458593 GCTGATGAACAACCTCAGCAAGG - Intergenic
933235119 2:79856108-79856130 CTTGATATATAACAACAGCATGG - Intronic
938315395 2:130323196-130323218 TATGATAAACAACTTCAGCAGGG - Intergenic
939894062 2:147770762-147770784 GCTGATAGGCAACTTCAGCAAGG + Intergenic
940383918 2:153048151-153048173 CCTAATAAGCAACAACAGCGTGG + Intergenic
940399043 2:153225611-153225633 ACTAATAAATAAATACAGCAAGG + Intergenic
940564762 2:155347393-155347415 GCTGATAAGCAACTTCATCAAGG - Intergenic
941221826 2:162791642-162791664 GCTGATAAGCAACTTCAGCAAGG - Intronic
941502037 2:166291206-166291228 ACTGATAAGCAACTTCAGCAAGG + Intronic
941856822 2:170239785-170239807 CCTAAGAAACAAATACAGCTGGG - Intronic
942397555 2:175567753-175567775 CCTGAAACACAACCCCAGCAGGG + Intergenic
943160579 2:184244881-184244903 ACTCATAGACAACTTCAGCAAGG + Intergenic
943549031 2:189315710-189315732 GCTGATAAACAACTTCAGGAAGG + Intergenic
943605522 2:189972844-189972866 GCTGATAAGCAACTTTAGCAAGG - Intronic
944580783 2:201130958-201130980 CCTGATAAACTTCCTCAGCAGGG - Intronic
945660145 2:212675688-212675710 GCTGATAAACAATTTTAGCAAGG - Intergenic
945714918 2:213346243-213346265 GCTGATAGGCAACTTCAGCAAGG - Intronic
945764751 2:213961265-213961287 ACTAATAAACAAATTCAGCAAGG - Intronic
947532310 2:230918341-230918363 CCAAATCAACAACTACATCAAGG - Intronic
1169393455 20:5209321-5209343 ACTAATAAACAAGTTCAGCAAGG + Intergenic
1169560615 20:6796655-6796677 CCTGATAAATAAATTCAACAAGG - Intergenic
1169643838 20:7786963-7786985 ACTAATAAACAACTATAGCAAGG + Intergenic
1170924467 20:20710904-20710926 ACTGATTAACACCTACTGCAGGG - Intronic
1171384508 20:24760922-24760944 ACTAATAAGCAATTACAGCAAGG + Intergenic
1172879070 20:38186545-38186567 ACTAATAAACAAATTCAGCAAGG - Intergenic
1174463892 20:50702397-50702419 CCTGAGAAACATCTGCGGCAGGG + Intergenic
1175022904 20:55869974-55869996 GCTGATCAACAACTTCAGTAAGG + Intergenic
1175127916 20:56766199-56766221 CCTCAAAAACAACAACAGCAAGG - Intergenic
1177320627 21:19514986-19515008 TCTGACAAACAACTTCAGCTGGG + Intergenic
951748065 3:26001430-26001452 GCTGATAAGCAACTACTGCTAGG - Intergenic
952310868 3:32188832-32188854 ACTAATAAACAAGTTCAGCAAGG - Intergenic
952573966 3:34751927-34751949 ACTGATAAATAACTTTAGCAAGG + Intergenic
952623270 3:35371932-35371954 ACTGATAAACTACTTCAGTAAGG + Intergenic
952811016 3:37402727-37402749 CCTGATAAGCAGCTATTGCAAGG - Intronic
953525123 3:43683210-43683232 GCTGATAAGCAACTTCAGCAAGG + Intronic
953876596 3:46670252-46670274 CCTGCTCCCCAACTACAGCAGGG + Exonic
954518695 3:51203297-51203319 GCTGATAAGCAAATTCAGCAAGG + Intronic
955538123 3:59946383-59946405 TTTGATAAACAACTTCAGCAAGG - Intronic
957200592 3:77130084-77130106 ACTGTTAAACAACCACAGAATGG + Intronic
959032143 3:101311349-101311371 ACTAATAAACAAGTTCAGCAGGG + Intronic
959325315 3:104929626-104929648 ACTGATAAAATACTTCAGCAAGG - Intergenic
959852320 3:111103490-111103512 GCTAATAATCAATTACAGCAAGG - Intronic
960176560 3:114524511-114524533 CCTGGTAGACAACTGCATCAAGG + Intronic
960730747 3:120724078-120724100 GCTGATAAGCTACTTCAGCAAGG + Intronic
962512076 3:136112417-136112439 TCTGATAAACGACTTCAGTAAGG + Intronic
962947230 3:140183036-140183058 CCAGGTAAATACCTACAGCAGGG + Intronic
963153067 3:142067251-142067273 ACTGATAAGCAATGACAGCAAGG + Intronic
963362642 3:144295359-144295381 CCTGACTAATAACTAAAGCAAGG + Intergenic
963553209 3:146751571-146751593 TCTGATAAACAACTTCAGCAGGG - Intergenic
963990594 3:151648935-151648957 GCTGATAAACAACTTCAGTAAGG + Intergenic
964408331 3:156373250-156373272 ACTGAAAAACAATTACAGCCGGG + Intronic
964582511 3:158255923-158255945 GCTGATAAGCAACTTCAGCAAGG - Intronic
964657723 3:159086779-159086801 GCTGATAAGCAACTTCAGTAAGG - Intronic
964995401 3:162872118-162872140 GCTGATAAGCAAATTCAGCAAGG + Intergenic
966133319 3:176669404-176669426 ACTGATAAACAAATTCAGTAAGG + Intergenic
966459601 3:180161684-180161706 ACTGAAAAACAACTTCAGTAAGG - Intergenic
966464866 3:180219299-180219321 ACTAATAAACAATTATAGCAAGG + Intergenic
966541238 3:181092342-181092364 TCTGATAAACAACTTCCGCAAGG - Intergenic
967547955 3:190753974-190753996 ACTGATAAGCAATTATAGCAAGG - Intergenic
967956094 3:194878498-194878520 CCTCAGAAACAACTCCAGGAAGG + Intergenic
969244922 4:5925735-5925757 CGAGATAAACACCTACACCAGGG + Intronic
969763069 4:9204621-9204643 ACTGATAAGCAACTTCACCAAGG + Intergenic
970383661 4:15534821-15534843 CCAGATATACAACGACAACAGGG - Intronic
970653888 4:18209499-18209521 TCTGATAAACAACTTAAGCAAGG - Intergenic
973013502 4:45107112-45107134 GCTGATAAGCAACTTCAGCAAGG - Intergenic
973091494 4:46142667-46142689 TCTGATAAACAAATTCAGTAAGG - Intergenic
973945573 4:55951072-55951094 ACTGATACACATCAACAGCATGG - Intronic
974044718 4:56888863-56888885 GCTGATAAGCAACTTCAGCAAGG + Intergenic
974654697 4:64803742-64803764 GCTGATAAGCAACTTCAGCAAGG + Intergenic
974854893 4:67449060-67449082 ACTAATAAGCAATTACAGCAAGG + Intergenic
975021199 4:69491578-69491600 CATGATAAACAATTAGAGAATGG + Intronic
975025408 4:69542488-69542510 GCTGATAAGCAACTTCAGCAAGG + Intergenic
975597014 4:76056918-76056940 CATGATAAACTACTAAAGTATGG - Intronic
975672095 4:76790346-76790368 CATGATAAACACCTCCAACAAGG + Intergenic
976071208 4:81241743-81241765 CCTCTCAAACAAATACAGCAGGG - Intergenic
976807027 4:89059625-89059647 ACTGATAAGGAACTTCAGCAAGG - Intronic
976979495 4:91209074-91209096 GCTGATAAACAACTTCAACAAGG - Intronic
977287003 4:95120540-95120562 ACTGATAAACGAGTTCAGCAAGG + Intronic
977729703 4:100336354-100336376 ACTGATAAGCAACTTCAGTAAGG + Intergenic
978208575 4:106108884-106108906 GCTGATAAACAACTTCAGTGAGG + Intronic
978213533 4:106168617-106168639 GCTAATAAGTAACTACAGCAAGG + Intronic
978835073 4:113139488-113139510 ACTGATGAACTACTAAAGCAGGG - Intronic
978995738 4:115149594-115149616 CCTAAGAAACGAATACAGCATGG + Intergenic
979154963 4:117373649-117373671 CATTATAAAAAATTACAGCATGG - Intergenic
979362339 4:119779642-119779664 GCTGATAAACAACTTCAGAAGGG - Intergenic
980509593 4:133768027-133768049 ACTGATAAACAACTTCAGTGAGG - Intergenic
980769700 4:137355140-137355162 GCTGATAAGCAACTTCAGCAAGG + Intergenic
981648149 4:147023392-147023414 GCTGATAAACAACTTCAATAAGG - Intergenic
981871404 4:149491129-149491151 CCTGTTAAAAAACTCCAACATGG - Intergenic
982077887 4:151756970-151756992 CTTGATAATTAACTACAACATGG + Intronic
983297743 4:165887615-165887637 CCTGAAAAACAACAACATGAGGG - Intronic
983402021 4:167277996-167278018 GCTGATAAGCAACTTCAGCAAGG - Intergenic
983502612 4:168516662-168516684 TCTCATTAACAACTGCAGCATGG - Intronic
983690351 4:170462289-170462311 GCTGATAAACAATTTCAGTAAGG - Intergenic
983835629 4:172380058-172380080 CCATATAAACAGCTAGAGCAGGG - Intronic
985072566 4:186182244-186182266 GCTGATAAGCAACTTCAGCAAGG - Intergenic
985193599 4:187404265-187404287 GCTAATAAGCAACTTCAGCAAGG - Intergenic
987673234 5:21041508-21041530 GCTGATAAACATTTTCAGCAAGG + Intergenic
987895169 5:23936002-23936024 GCTAATAAACAAATTCAGCAAGG - Intergenic
987997803 5:25308645-25308667 GCTGATAAGCAACTTCAGCAAGG - Intergenic
990932530 5:61109311-61109333 ACTGATAAACAAATTCAGTAAGG - Intronic
991484339 5:67119109-67119131 CCTGATAAACATGAACAACAGGG - Intronic
993878973 5:93341198-93341220 CCTGAAAAACAAATTCTGCAAGG - Intergenic
994333415 5:98534965-98534987 CCTCATAAACTACTAGTGCAAGG + Intergenic
994351043 5:98746595-98746617 GCTGATAAGCAACTTCAGCAAGG + Intergenic
994601610 5:101912470-101912492 GCTGATAAACAATTTTAGCAAGG - Intergenic
995311211 5:110713987-110714009 CCTGAAAAACAATTGCAGCTGGG - Intronic
995383908 5:111567451-111567473 ACTGATAGGCAACTTCAGCAAGG - Intergenic
995735024 5:115290841-115290863 ACTAATAAACAAGTACAGCAAGG - Intronic
995744515 5:115389972-115389994 CCTGCTCAACATCTGCAGCAAGG - Intergenic
995946664 5:117655922-117655944 CCTGACAAACTACTTCAGCTTGG + Intergenic
995982733 5:118125071-118125093 ACTAATAAACAATTTCAGCAAGG + Intergenic
997143007 5:131402937-131402959 ACTAATAAACAAATTCAGCAAGG + Intergenic
997857564 5:137386010-137386032 GCTAATAAGCAATTACAGCAAGG + Intronic
998110224 5:139495752-139495774 CCTGATAAGCCACTCCAACAAGG - Intergenic
1001499709 5:172220898-172220920 CCTAATAAGCAATTATAGCAAGG + Intronic
1001760239 5:174202108-174202130 GCTGATAAACAACTTCAGCAAGG - Intronic
1001777558 5:174340043-174340065 CCTGACACACAACCTCAGCAAGG + Intergenic
1002892190 6:1344618-1344640 ACTAATAAACAATTACAGCAAGG + Intergenic
1003364835 6:5463322-5463344 ACTAATAAACAACTTTAGCAAGG - Intronic
1004887815 6:20068771-20068793 TCTGATAGACACATACAGCAGGG + Intergenic
1005596918 6:27388691-27388713 CCTGAGAGCCAGCTACAGCAGGG - Intronic
1006252767 6:32803513-32803535 GTTGATAAACAACTTCAGCAAGG - Intergenic
1008640738 6:53459917-53459939 ACTGATAAACAAATTCAGTAAGG + Intergenic
1008736556 6:54551461-54551483 TCTGATAAACAACTTCAGCAAGG + Intergenic
1009033178 6:58084948-58084970 ACTGATAAACAACTTCAGTAAGG + Intergenic
1009160491 6:60276438-60276460 GCTGATAAGCAACTTCAGCAAGG - Intergenic
1009208786 6:60836719-60836741 ACTGATAAACAACTTCAGTAAGG + Intergenic
1010183075 6:73110734-73110756 CATTATAAAGAACTACAGCTGGG + Intronic
1010811317 6:80302279-80302301 ACTGATAAACAATTTTAGCAAGG + Intronic
1012003883 6:93688271-93688293 ACTGATAAACAAATTCAGTAAGG + Intergenic
1012742098 6:103030595-103030617 CCTGATAAATAATTGCAGCAAGG - Intergenic
1013533876 6:111045919-111045941 ACTAATAAACAAGTTCAGCAAGG - Intergenic
1013911470 6:115280894-115280916 CCAAATAAACAAATACAGCCAGG - Intergenic
1014907494 6:127047513-127047535 GCTGATGAGCAACTTCAGCAAGG + Intergenic
1022625155 7:32028040-32028062 CCTGATTGACAGCTAGAGCAGGG + Intronic
1022816954 7:33923116-33923138 CGTGATACTCATCTACAGCAGGG - Intronic
1023962635 7:44939811-44939833 GCTAATAAACAATTATAGCAAGG + Intergenic
1024023716 7:45393435-45393457 CCTAATGAACAAGTTCAGCAAGG - Intergenic
1024868454 7:53932453-53932475 GCTGATAAGCAACTTCAGCAAGG + Intergenic
1028080680 7:86571457-86571479 GCTGATAAGCAACTTCAGGAAGG + Intergenic
1031314221 7:120236689-120236711 GGTGATAAGCAACTTCAGCAAGG - Intergenic
1031612172 7:123840849-123840871 GCTGATAAGCAACTTCAGCAAGG - Intronic
1033888388 7:145977036-145977058 GCGGATAAACAACTTCAGCAAGG - Intergenic
1036656842 8:10682326-10682348 CCTGGTAAACTAATACTGCACGG - Intronic
1036864783 8:12386590-12386612 ACTGATAAGCAACTTCACCAAGG - Intergenic
1037285023 8:17290061-17290083 GCTGATAAGCAACTTCAGCAAGG - Intronic
1038752526 8:30309453-30309475 ACTGATAAGTAACTATAGCAAGG - Intergenic
1039139102 8:34363474-34363496 TCTAATAAACAAATTCAGCAAGG - Intergenic
1039265588 8:35820261-35820283 GCTGATAAGCAACTTCAGCAAGG + Intergenic
1039289652 8:36080139-36080161 GCTGATAAAGAACTTCAGCAAGG + Intergenic
1039383619 8:37110082-37110104 GCTGATAAACAACTTCAGCAGGG + Intergenic
1041274572 8:56143477-56143499 CCTGTGACACAACCACAGCATGG + Intergenic
1041470788 8:58206464-58206486 GTTGATAAAGAACTTCAGCAAGG - Intergenic
1042108268 8:65351956-65351978 GCTGATAAACAACTTCCTCAAGG - Intergenic
1042719834 8:71815228-71815250 CCTATGAAACAACTTCAGCATGG + Intergenic
1043133876 8:76496891-76496913 GCTGATAAACAACTTCAGCAAGG + Intergenic
1043346301 8:79302434-79302456 GCTCATAAACATCTACAGCCAGG + Intergenic
1043648227 8:82550645-82550667 CCTGATAAACAATTATAGACAGG - Intergenic
1044199969 8:89423029-89423051 TCTGATAAACAACTTCAGCGAGG + Intergenic
1045037422 8:98186580-98186602 CCTGGTAAACATCTATAACATGG - Intergenic
1045193097 8:99902709-99902731 GCTGATAAGCAACTTGAGCAAGG - Intergenic
1045523060 8:102920048-102920070 CCTGAGAAACCACTTCATCAAGG - Intronic
1045592141 8:103610193-103610215 TCTGATAAACAACTTCAGCAAGG - Intronic
1045643380 8:104276550-104276572 CCTGATGAACAATTTCAACATGG + Intergenic
1046159911 8:110348097-110348119 ACTGAAAAACAACTAGGGCAGGG - Intergenic
1049557122 8:143288525-143288547 CCTGAAAAACAAAGACAGCTGGG - Intergenic
1050753218 9:8965917-8965939 ACTGATAAACAATTTTAGCAAGG + Intronic
1050823832 9:9918179-9918201 CTTGATAAATAAATTCAGCAAGG + Intronic
1050891198 9:10826651-10826673 GCTGAGAAACAACTTCAGCAAGG - Intergenic
1051237173 9:15013635-15013657 CCAGAAACACAACTACAGTAGGG - Intergenic
1052344304 9:27393181-27393203 CCTTTTAAACACCTATAGCAAGG - Intronic
1054874374 9:70079793-70079815 CCTGTCAAACAACTTCTGCAAGG - Intronic
1055214896 9:73847463-73847485 TCTTATAAACAACAACAACAAGG + Intergenic
1055537540 9:77264658-77264680 GCTCATAAGCAACTTCAGCAAGG - Intronic
1055746529 9:79452279-79452301 ACTAATAAACAAATATAGCAAGG - Intergenic
1057891322 9:98872137-98872159 AGGAATAAACAACTACAGCAGGG - Intergenic
1058992046 9:110263628-110263650 ACTAATAAACAAGTTCAGCAAGG + Intergenic
1060715762 9:125927211-125927233 CCTAATAAACATCTACAGATTGG - Intronic
1186173130 X:6898529-6898551 CTTTTTAAACAACTAAAGCAGGG + Intergenic
1187351875 X:18526298-18526320 ACTACTAAACAATTACAGCAAGG - Intronic
1189092258 X:38097338-38097360 ACTGATAAACAAGTTCAGCAAGG + Intronic
1189956547 X:46280902-46280924 ACTGATAAACAAGTTCAGCGAGG + Intergenic
1190212283 X:48458589-48458611 CCTGACAAACAGCTTCAGCCAGG + Exonic
1190601983 X:52102436-52102458 GCTGATAAGCAAATTCAGCAAGG - Intergenic
1191046118 X:56138947-56138969 TCTTATAAACAACTTCAGGAAGG + Intergenic
1191159718 X:57316030-57316052 ACTGATAAACAATTTTAGCAAGG + Intronic
1191217395 X:57947690-57947712 GCTGATAGGCAACTTCAGCATGG - Intergenic
1191684481 X:63875339-63875361 GCTGATAAGCAACTTCAGCAAGG + Intergenic
1191733861 X:64367889-64367911 GCTGATAGGCAACTTCAGCAAGG + Intronic
1191967206 X:66772248-66772270 ACTGAGAAACAAATACAGTAAGG - Intergenic
1192056025 X:67774359-67774381 CCTGATAAACAACTTCAGAAAGG + Intergenic
1192160663 X:68784242-68784264 CCTGATCAACAACTTCAGGGTGG + Intergenic
1192712243 X:73603362-73603384 GCTGATTAGCAACTTCAGCAAGG - Intronic
1192760999 X:74096476-74096498 GCTGATAAGCAACTTCAGCAAGG - Intergenic
1192898054 X:75465084-75465106 GCTAATAAGCAACTTCAGCAAGG + Intronic
1193186925 X:78524119-78524141 CCTGATAAATCACTTTAGCAAGG + Intergenic
1193936780 X:87632693-87632715 AATAATATACAACTACAGCAAGG + Intronic
1194261077 X:91696845-91696867 TCTGATAAAGAACTTCAGCAAGG - Intergenic
1194498302 X:94646538-94646560 CCTAATAGAGAACTACAGCATGG - Intergenic
1194578675 X:95643975-95643997 CCTGATAAAAAAAGAAAGCAAGG + Intergenic
1194888611 X:99349937-99349959 CCTGATAAACTACTTCAGTAAGG - Intergenic
1195028557 X:100903364-100903386 ACTAATAAACAATTATAGCAGGG + Intergenic
1195155574 X:102120037-102120059 TTTGATAAACAACTTCAGCAAGG + Intergenic
1195830858 X:109056908-109056930 GCTGATAAGCAACTTCAGCAAGG + Intergenic
1195898005 X:109768363-109768385 ACTAATAAACAATTATAGCAAGG + Intergenic
1196561616 X:117155962-117155984 GCTGATAAGCAGCTTCAGCAGGG + Intergenic
1197186063 X:123588649-123588671 ACTAATAAACAACTTCAGCAAGG - Intergenic
1197399554 X:125973873-125973895 GCTGATAAGCAACTTCACCAAGG + Intergenic
1197625264 X:128794844-128794866 GTTGATAAGCAACTTCAGCAAGG + Intergenic
1197847438 X:130818046-130818068 GCTGATAAGCAACTTCCGCAAGG + Intronic
1199062141 X:143370065-143370087 ACTCATAACCAATTACAGCAAGG + Intergenic
1199365665 X:146979305-146979327 GCTGATAAACAACTTCAGCAAGG - Intergenic
1199564000 X:149195182-149195204 GCTGATAAGCAACCTCAGCAAGG + Intergenic
1200579726 Y:4935647-4935669 TCTGATAAAGAACTTCAGCAAGG - Intergenic