ID: 909698184

View in Genome Browser
Species Human (GRCh38)
Location 1:78491028-78491050
Sequence TGCGGGGCGCGCGCGGCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 244}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909698184_909698195 11 Left 909698184 1:78491028-78491050 CCAGGAGCCGCGCGCGCCCCGCA 0: 1
1: 0
2: 3
3: 29
4: 244
Right 909698195 1:78491062-78491084 AAGGGAACGAGTGCGCGGAGGGG 0: 1
1: 0
2: 0
3: 5
4: 97
909698184_909698197 23 Left 909698184 1:78491028-78491050 CCAGGAGCCGCGCGCGCCCCGCA 0: 1
1: 0
2: 3
3: 29
4: 244
Right 909698197 1:78491074-78491096 GCGCGGAGGGGACGAGCGGCTGG 0: 1
1: 0
2: 4
3: 30
4: 305
909698184_909698196 19 Left 909698184 1:78491028-78491050 CCAGGAGCCGCGCGCGCCCCGCA 0: 1
1: 0
2: 3
3: 29
4: 244
Right 909698196 1:78491070-78491092 GAGTGCGCGGAGGGGACGAGCGG 0: 1
1: 0
2: 0
3: 10
4: 241
909698184_909698192 6 Left 909698184 1:78491028-78491050 CCAGGAGCCGCGCGCGCCCCGCA 0: 1
1: 0
2: 3
3: 29
4: 244
Right 909698192 1:78491057-78491079 GCGCTAAGGGAACGAGTGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 28
909698184_909698188 -7 Left 909698184 1:78491028-78491050 CCAGGAGCCGCGCGCGCCCCGCA 0: 1
1: 0
2: 3
3: 29
4: 244
Right 909698188 1:78491044-78491066 CCCCGCAGTTTCCGCGCTAAGGG 0: 1
1: 0
2: 0
3: 1
4: 18
909698184_909698193 9 Left 909698184 1:78491028-78491050 CCAGGAGCCGCGCGCGCCCCGCA 0: 1
1: 0
2: 3
3: 29
4: 244
Right 909698193 1:78491060-78491082 CTAAGGGAACGAGTGCGCGGAGG 0: 1
1: 0
2: 0
3: 4
4: 27
909698184_909698186 -8 Left 909698184 1:78491028-78491050 CCAGGAGCCGCGCGCGCCCCGCA 0: 1
1: 0
2: 3
3: 29
4: 244
Right 909698186 1:78491043-78491065 GCCCCGCAGTTTCCGCGCTAAGG 0: 1
1: 0
2: 0
3: 2
4: 22
909698184_909698194 10 Left 909698184 1:78491028-78491050 CCAGGAGCCGCGCGCGCCCCGCA 0: 1
1: 0
2: 3
3: 29
4: 244
Right 909698194 1:78491061-78491083 TAAGGGAACGAGTGCGCGGAGGG 0: 1
1: 0
2: 0
3: 3
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909698184 Original CRISPR TGCGGGGCGCGCGCGGCTCC TGG (reversed) Intronic