ID: 909700856

View in Genome Browser
Species Human (GRCh38)
Location 1:78521077-78521099
Sequence GTGTCTATAGAGCTGGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 220}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909700856 Original CRISPR GTGTCTATAGAGCTGGGGGA TGG (reversed) Intronic
902780006 1:18698926-18698948 GTGTCTGCTGAGATGGGGGAGGG - Intronic
903742903 1:25568610-25568632 GTGGCTACAGAGCAGGGGCAAGG - Exonic
903975564 1:27147634-27147656 GTTTTTTTAGAGATGGGGGATGG - Intronic
904746878 1:32716791-32716813 CTCTCTCCAGAGCTGGGGGAGGG - Intergenic
904847963 1:33435039-33435061 GTGTATATATGGATGGGGGAAGG - Intergenic
905319457 1:37105589-37105611 AGGTCTATAGAGGTGGGGGCGGG + Intergenic
907992950 1:59600570-59600592 GTGTCCAAAGAGCTGGGTGCAGG - Intronic
908171046 1:61505074-61505096 TAATCTATAGAGCTGGGGAAAGG + Intergenic
908490354 1:64637271-64637293 GAGTCAAGTGAGCTGGGGGAAGG + Intronic
909700856 1:78521077-78521099 GTGTCTATAGAGCTGGGGGATGG - Intronic
911320198 1:96404570-96404592 GTGACTATAGAGATAGGAGAGGG + Intergenic
912937597 1:114017429-114017451 GTGTCTAAATTGCTGGAGGAAGG + Intergenic
913048926 1:115098465-115098487 GTGTTCATAGTCCTGGGGGAAGG + Intergenic
914429159 1:147604240-147604262 CTGTGGATAGACCTGGGGGACGG - Intronic
914753804 1:150552148-150552170 GTGTCCAGAGAGCTTGGGGCTGG - Intronic
915823616 1:159052214-159052236 TTATCTCTAGTGCTGGGGGAAGG - Intronic
917779737 1:178380566-178380588 GTGTCTATTGAGTGGGGGTAGGG + Intronic
918325187 1:183403399-183403421 GGTTCTATTGAGTTGGGGGAAGG + Intronic
918470285 1:184865443-184865465 GGGACTATAGAGGTGGGGGAAGG + Intronic
920179956 1:204126429-204126451 GTGTCTATCCACCTGGGGTATGG + Exonic
920500569 1:206482542-206482564 GTGTCTAGAGAGCTGGGGTCAGG + Intronic
921251539 1:213302965-213302987 GTTTCTATAGACCTGGGGTAGGG - Intergenic
921951232 1:220932193-220932215 GTGTCCATGGGGCTGGGGGTGGG + Intergenic
924593061 1:245421787-245421809 GCGTCTTTGGAGCTGGGGAAAGG + Intronic
1064623696 10:17240920-17240942 GTGTGTGTAGTGATGGGGGAGGG + Intergenic
1065000608 10:21334631-21334653 GTGTCTCTGGGGCTGGGGGCTGG - Intergenic
1065356851 10:24850632-24850654 GTGTCTTTAAAGAGGGGGGAGGG + Intronic
1066252601 10:33649068-33649090 GTGGATATACAGCAGGGGGATGG + Intergenic
1067083049 10:43222403-43222425 TTGTCCCTAGAGCTGGGGGTGGG - Intronic
1069184079 10:65400478-65400500 GTGTCTGGAGTGGTGGGGGAAGG - Intergenic
1070446506 10:76509838-76509860 GTGTGTATTGGGTTGGGGGAAGG + Intronic
1071051694 10:81458461-81458483 CTGTCTACAGAGCTAAGGGAAGG + Intergenic
1072424679 10:95320145-95320167 TTGGCAAGAGAGCTGGGGGAAGG - Intronic
1072763737 10:98079645-98079667 GTGTGTATAGAGTTGGGGGCGGG + Intergenic
1073073860 10:100811123-100811145 GTGTGTGGAGAGGTGGGGGAGGG + Intronic
1073307241 10:102512889-102512911 TTTTCTGTAGAGATGGGGGAGGG - Intronic
1073473046 10:103735703-103735725 GTGTATCTGGGGCTGGGGGAGGG - Intronic
1075948530 10:126458029-126458051 CTGTCTAAAGACCTCGGGGAAGG - Intronic
1076275906 10:129198272-129198294 ATGTTAATAGAGTTGGGGGAGGG - Intergenic
1076616556 10:131759052-131759074 GAGTCTCCAGGGCTGGGGGAGGG - Intergenic
1077140015 11:1020164-1020186 GTGTGATTAGAGCTGGGTGAGGG + Exonic
1077887230 11:6395167-6395189 GTGCCCATGGAGCAGGGGGAAGG + Exonic
1078826785 11:14937546-14937568 CTGACTGTAGAGATGGGGGAGGG - Intronic
1079096235 11:17512161-17512183 GTGGTGAGAGAGCTGGGGGAGGG - Intronic
1079384035 11:19963051-19963073 GGCTCTATAGAGAAGGGGGAAGG + Intronic
1083604883 11:63972540-63972562 GTGTTTGTAGAGCTGGAGGGGGG - Intergenic
1083618295 11:64036816-64036838 TTGTCTTGAGAGCTGGGGGATGG - Intronic
1085026979 11:73242086-73242108 GTGTGTAGAGAGCTGGGGCAAGG + Intergenic
1086076723 11:82862569-82862591 GTGTAGATAGAGCTGGGTGCAGG - Intronic
1088268894 11:108013776-108013798 GTGTCTATAGAGGCCGGGCATGG + Intronic
1088977680 11:114830317-114830339 GTGTCAAGAGAGCTGTGGGAAGG + Intergenic
1090580177 11:128150969-128150991 GTGTCTTTAGAGCACAGGGAGGG + Intergenic
1095850977 12:46805883-46805905 GTGTCTATAGGGGTAGGGGCTGG + Intronic
1097712684 12:62933687-62933709 GTGGCCATGGAGCTGGGGGAAGG + Intronic
1098283447 12:68884480-68884502 GTTCCTATAGAGTTTGGGGAGGG + Intronic
1099133327 12:78863782-78863804 GGGTCGAGAGAGATGGGGGAGGG + Intergenic
1099135428 12:78892511-78892533 GTGTTTAGAGAGGTGGGGAAAGG - Intronic
1099640069 12:85275459-85275481 ATGTCTGCAGAGCTGTGGGAAGG + Intergenic
1102303576 12:111788607-111788629 GTTTGTATAGATCTGGGGGAGGG + Intronic
1103316841 12:120062968-120062990 GGGTGTATAGCGCTGGGTGAGGG + Intronic
1108201946 13:48053001-48053023 GGGACTAAAGGGCTGGGGGATGG + Intergenic
1112429815 13:99341546-99341568 GTGTATTTAAAGCTGGAGGATGG + Intronic
1114514790 14:23291598-23291620 TTTTCTGTAGAGATGGGGGACGG - Intronic
1114527839 14:23377472-23377494 GTGTCCAGAGGGCTTGGGGAAGG - Intronic
1117522735 14:56566910-56566932 GTGTTTATAGAAGTAGGGGAAGG - Intronic
1118615552 14:67572377-67572399 GGGTCCCTAGAGCTGGGGGATGG + Intronic
1119373444 14:74167706-74167728 TTTTTTATAGAGATGGGGGAGGG + Intronic
1119470953 14:74898816-74898838 GGGCCTGTGGAGCTGGGGGAGGG - Intronic
1120402146 14:84045300-84045322 GGGAATAAAGAGCTGGGGGAAGG - Intergenic
1122906503 14:104804046-104804068 GTCTCGAGACAGCTGGGGGAGGG + Exonic
1123033092 14:105460347-105460369 GTGCCCACAGAGCTGGGGAAAGG - Exonic
1127417438 15:58771364-58771386 GTCTCCATAGAGCTGGGGGCGGG + Exonic
1128542230 15:68544088-68544110 CTGTCTACAGAGCTTGGGGAAGG - Intergenic
1128666094 15:69539420-69539442 GTCACCATAGAGCTGGTGGAAGG - Intergenic
1133713743 16:8427280-8427302 CTTTCTATAGAGCTGTGGGGTGG - Intergenic
1133965405 16:10527503-10527525 TTGTCCATATGGCTGGGGGATGG - Intergenic
1134136119 16:11677437-11677459 GTGCCTTTAGAGCTGGGTCAGGG - Exonic
1136043633 16:27599378-27599400 GTGGCTATTGAGATGGGGGTGGG + Intronic
1136114834 16:28087971-28087993 GTGTCTGTGGGGTTGGGGGAGGG - Intergenic
1136456338 16:30381872-30381894 GTGTCAAGCGAGCTGTGGGATGG + Exonic
1138309743 16:56013250-56013272 GGGTCCCTAGACCTGGGGGATGG - Intergenic
1139450590 16:67025687-67025709 GTTTCTTTAGAGTCGGGGGAGGG + Intergenic
1140558445 16:75948259-75948281 CTGTCTTTAGAGATGGAGGAAGG + Intergenic
1140866228 16:79064944-79064966 GTGTTTATAGAGATGGAGCATGG + Intronic
1142854435 17:2721990-2722012 ATTGCTATAGAGCTGGGGGGAGG + Intergenic
1144523324 17:15968874-15968896 GTGTCCGGACAGCTGGGGGAGGG + Intronic
1145005414 17:19334620-19334642 GTGTCCCTAGGGCTGGGGGGTGG - Exonic
1147424107 17:40337561-40337583 GTGTCTGGAGATCGGGGGGAGGG - Intronic
1148067508 17:44883214-44883236 GTGTATTGGGAGCTGGGGGAAGG - Intronic
1149518453 17:57299501-57299523 GTGTCTACAGGCCTGCGGGAAGG + Intronic
1150054250 17:61997735-61997757 GTGTCTTTCAGGCTGGGGGAAGG - Intronic
1151221454 17:72615909-72615931 GTGTCTCCAGAGTAGGGGGAGGG - Intergenic
1151461447 17:74256541-74256563 GTGTTTGTAAAGCTGTGGGATGG - Intronic
1152900814 17:82940051-82940073 GTGTGTATTGAGTTGGGGGTGGG + Intronic
1156841811 18:41617867-41617889 CTGTCTGTGGAGGTGGGGGAAGG - Intergenic
1157080141 18:44515662-44515684 GTCTCTCTAAATCTGGGGGAAGG + Intergenic
1158823683 18:61190172-61190194 GTGTCTATGTTGCAGGGGGATGG + Intergenic
1159624411 18:70675384-70675406 GTGTGTAAAGGGATGGGGGAAGG + Intergenic
1160035363 18:75296716-75296738 GTGTGTGCAGAGCAGGGGGACGG + Intergenic
1160769158 19:822464-822486 GAGACAAAAGAGCTGGGGGAGGG + Intergenic
1160823283 19:1067941-1067963 GTGTCTACAAAGCTGGGGGGGGG + Intronic
1161432604 19:4242107-4242129 GAGTTTATATAGCTGGGGAATGG + Intergenic
1162500834 19:11052734-11052756 CTGTCTGCAGGGCTGGGGGAGGG - Intronic
1162559947 19:11411298-11411320 CAGGCGATAGAGCTGGGGGAAGG - Intronic
1163452603 19:17387394-17387416 GTGTGTGTAGGGCTTGGGGAGGG - Intergenic
1166844658 19:45719348-45719370 GAGTCCCTAGGGCTGGGGGAGGG + Intronic
1167378305 19:49124061-49124083 GTGTCTATAGGGCGGGGAGGGGG - Intronic
1167690223 19:50980538-50980560 GTGTGCAAAGACCTGGGGGACGG + Intronic
926277563 2:11416349-11416371 GTGACTCAAGAGCTGGGGGTTGG + Intergenic
929799303 2:45085642-45085664 GTGTCTGTGGAGCTGGGGCTTGG - Intergenic
930630187 2:53745206-53745228 GTGTATATGGAGCAAGGGGAAGG + Intronic
932562298 2:72883987-72884009 ATGTCTTTAGAGGTTGGGGAGGG - Intergenic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
934040965 2:88127163-88127185 GTGTCTAGGGAACTGGGGGCAGG - Intronic
934101840 2:88660605-88660627 GTGTGTATGCAGGTGGGGGAGGG + Intergenic
937985059 2:127634692-127634714 GCCTCTGTGGAGCTGGGGGAGGG + Intronic
938072640 2:128316713-128316735 GTGTGTGTACAGTTGGGGGAGGG + Intronic
938215080 2:129504522-129504544 GTGGCTATACAGCTGGAAGATGG - Intergenic
940639752 2:156333521-156333543 GTTTCTAAAGAGCTGGGTCACGG - Intronic
942922168 2:181388325-181388347 GTGTGTTGAGAGCTGGGAGAAGG - Intergenic
1168955348 20:1830550-1830572 GCCTCTATGCAGCTGGGGGAAGG + Intergenic
1169235231 20:3925168-3925190 GTTTCTCTAGAGTAGGGGGAGGG - Intronic
1171462953 20:25309153-25309175 GCGTCTTCAGAGCTGAGGGAGGG - Intronic
1171489318 20:25505300-25505322 GTGGCTACAGAGCTGGGTGGTGG + Intronic
1175650370 20:60716364-60716386 ATTTCTTTAGAGCTTGGGGAAGG - Intergenic
1177399845 21:20588212-20588234 GTATATATATACCTGGGGGAGGG + Intergenic
1179100593 21:38352587-38352609 GTGTCTATAGATCTGTAGGCAGG - Intergenic
1179635197 21:42704278-42704300 GTGACTATGGAGATGTGGGAGGG - Intronic
1181795628 22:25307077-25307099 ATTTCTATAGAGATGGGGGCCGG - Intergenic
1182585124 22:31340534-31340556 GTGGCTGTAGGGCTGGAGGAGGG + Intronic
1183299323 22:37051312-37051334 GTGTGTATAGGGGTGGGGGCGGG - Intergenic
1183639716 22:39085440-39085462 GGGGCTGTAGAGCTGGGGGAGGG - Intronic
1184032341 22:41902525-41902547 CTGTCGATGGGGCTGGGGGAAGG - Intronic
1184274777 22:43404139-43404161 GGGACAGTAGAGCTGGGGGAGGG - Intergenic
1184598518 22:45528712-45528734 GTGTCAATTGGGCTGGGGTATGG - Intronic
1184799615 22:46751693-46751715 CTGGCAACAGAGCTGGGGGAAGG + Intergenic
1184958066 22:47905841-47905863 GGGGGTATGGAGCTGGGGGATGG + Intergenic
1185152832 22:49175860-49175882 GTGGCTTTAGAACTGGGTGACGG + Intergenic
949312943 3:2720695-2720717 AAGTCTATAATGCTGGGGGAGGG - Intronic
949857894 3:8478567-8478589 GTGGCTAGTGTGCTGGGGGAGGG - Intergenic
950540711 3:13610595-13610617 GTGTCTGTAAAGCCGTGGGAGGG + Intronic
950637526 3:14325224-14325246 GTGGCTACAGAGCAGGGAGAGGG - Intergenic
952450612 3:33429003-33429025 CTGTGTATAGAGCTAGGGTAGGG - Intronic
952784669 3:37141456-37141478 GTGTCTATAGAGCTCTTAGAAGG + Intronic
953455075 3:43034569-43034591 GTCTCTATAGAAATGGGGGCTGG - Intronic
953538480 3:43793803-43793825 GTGGCTATAGAGGTGGGGGCAGG + Intergenic
953557694 3:43959888-43959910 GTGTCTACAGGGCAGAGGGAGGG - Intergenic
953975460 3:47378893-47378915 GTGTCTGTTGGGCTAGGGGAGGG - Intergenic
954583879 3:51718254-51718276 GAGTCTGAAGAGCTGGGGTAAGG - Exonic
954951224 3:54475674-54475696 GTCTCAATAAAGCTGGGAGAGGG - Intronic
955693890 3:61616588-61616610 GTGTCTATATGGCAGGGAGAAGG - Intronic
961358645 3:126354271-126354293 GTGTTTATCAAGCTTGGGGAAGG + Intronic
961485390 3:127212350-127212372 GTGTGTCTGGAGGTGGGGGATGG - Intergenic
962124173 3:132597660-132597682 GTGTCTATATATCTGCCGGAAGG + Intronic
963563860 3:146902832-146902854 GAATCTATAGTGCTGGGAGAGGG + Intergenic
965596200 3:170413818-170413840 TTTTTTATAGAGATGGGGGAGGG - Intergenic
967112257 3:186304232-186304254 GTGTTTTTGGAGCTGGGGGTGGG + Intronic
967824833 3:193869759-193869781 GTGTCTGCAGGGCTGGGGGCGGG - Intergenic
972129646 4:35816163-35816185 ATGTCTCTGGGGCTGGGGGAGGG - Intergenic
972309532 4:37867082-37867104 GTTTCGCTAGAGCTGGGTGATGG - Intergenic
974692231 4:65311369-65311391 GAGTCAATAGACTTGGGGGAAGG - Intergenic
976841120 4:89433338-89433360 GTGGCTAAAGGTCTGGGGGAAGG + Intergenic
977196336 4:94065379-94065401 GTGTCTTTTGAACTGGTGGATGG - Intergenic
978872099 4:113591862-113591884 GTGTCTAATGAGCTGGGGAATGG - Intronic
980892917 4:138833787-138833809 GTGTAAATAGTGCTGGGGGTGGG - Intergenic
982187521 4:152818271-152818293 GTGTCTCCAGAGCTTGGGAAGGG + Intronic
983222331 4:165054931-165054953 TTGTGTATAGAGTTGGGGGTGGG + Intergenic
984251692 4:177343506-177343528 ATGTCTGTAGAGCTGGGGGCAGG + Intronic
985010714 4:185579757-185579779 TTGAGTATGGAGCTGGGGGAAGG + Intergenic
986233211 5:5885597-5885619 GTGTCCAGAGAGCTGGGGAATGG + Intergenic
986493473 5:8317802-8317824 GTGTCTAGAGAGCCCTGGGAAGG - Intergenic
986653131 5:9984448-9984470 GTGTCGGTAGTGCTGGGGTAGGG - Intergenic
988798406 5:34673859-34673881 GGGTTTTTAGAGTTGGGGGAGGG - Intronic
988965377 5:36411512-36411534 GGGGCTGGAGAGCTGGGGGAGGG - Intergenic
991941951 5:71861938-71861960 GTGTATATGGAGCTATGGGATGG + Intergenic
993040524 5:82809462-82809484 TTTTCTATTGAGCTTGGGGATGG - Intergenic
993727425 5:91383777-91383799 GTGTGAAGAGAGATGGGGGAAGG + Intergenic
995303132 5:110609578-110609600 GTGTCTATAGGCATGTGGGATGG + Intronic
998686496 5:144533202-144533224 GTGTCTATAAAGGTGGGGGTGGG - Intergenic
1000009600 5:157218884-157218906 GTGTCCAAAACGCTGGGGGAGGG + Intronic
1000268664 5:159661959-159661981 GTGTCTAGACAGGTGTGGGAGGG - Intergenic
1001013062 5:168115902-168115924 ATGTCTGTAGAGGTGTGGGAAGG + Intronic
1005311422 6:24563064-24563086 GTGTCTTCAGAGCTGGGCAAGGG - Intronic
1008315158 6:50030557-50030579 GTGTCTATATTTCTGTGGGATGG - Intergenic
1010682941 6:78817943-78817965 GTGGCAATGGGGCTGGGGGAGGG + Intergenic
1012340709 6:98119755-98119777 GTTTGTATAGAGCTTGAGGAAGG - Intergenic
1012448161 6:99327858-99327880 GTGTTTATAGAGTTGGAGAAAGG - Intronic
1016663620 6:146609971-146609993 GTGACTATATAACTTGGGGATGG + Intronic
1016985074 6:149889009-149889031 GTGGCATTAGAGCTGGTGGAAGG + Intronic
1017140051 6:151182270-151182292 GTGTCTCTAGTGCTGGGGGTGGG - Intergenic
1017140066 6:151182319-151182341 GTGTCTCTAGTGCTGGGGGTGGG - Intergenic
1018548298 6:164962816-164962838 CTGCCTATGGAGCTGTGGGAAGG + Intergenic
1019375563 7:689990-690012 GTTTTTAAAGAGCTGAGGGAGGG + Intronic
1021421091 7:20445288-20445310 GTGACTGTAGAGCTGTGGAAGGG + Intergenic
1022244645 7:28546883-28546905 GTGTGGATAGAGCTGGGGTTGGG + Intronic
1023205219 7:37741726-37741748 GTGTCTTTGGAGCTGGGTGGTGG - Intronic
1023314389 7:38920406-38920428 GTGTCTTTAGAGCGGGGTAATGG - Intronic
1023481156 7:40636203-40636225 GTGGCTCTAAAGCTGGGGGCTGG + Intronic
1023826000 7:44009698-44009720 GTTTCTATAAAGCTGTGTGATGG + Exonic
1024294160 7:47829697-47829719 GTGTCTTTAAAACTGGGAGATGG - Intronic
1026089569 7:67288567-67288589 GTTTCTATAAAGCTGTGTGATGG + Intergenic
1026724714 7:72861941-72861963 GTTTCTATAAAGCTGTGTGATGG - Intergenic
1026746847 7:73020136-73020158 GTTTCTATAAAGCTGTGTGATGG - Intergenic
1026750499 7:73048279-73048301 GTTTCTATAAAGCTGTGTGATGG - Intergenic
1026754146 7:73076389-73076411 GTTTCTATAAAGCTGTGTGATGG - Intergenic
1026757797 7:73104425-73104447 GTTTCTATAAAGCTGTGTGATGG - Intergenic
1026920384 7:74151212-74151234 TTTTCTGTAGAGATGGGGGATGG - Intergenic
1027089606 7:75289062-75289084 GTTTCTATAAAGCTGTGTGATGG + Intergenic
1027093251 7:75316990-75317012 GTTTCTATAAAGCTGTGTGATGG + Intergenic
1027096894 7:75344957-75344979 GTTTCTATAAAGCTGTGTGATGG + Intergenic
1027119162 7:75503877-75503899 GTTTCTATAAAGCTGTGTGATGG + Intergenic
1027272663 7:76531730-76531752 GTTTCTATAAAGCTGTGTGATGG - Intergenic
1027322454 7:77022723-77022745 GTTTCTATAAAGCTGTGTGATGG - Intergenic
1027326112 7:77050808-77050830 GTTTCTATAAAGCTGTGTGATGG - Intergenic
1027525645 7:79266097-79266119 GTATCTCCAGAGCTGGAGGATGG + Intronic
1029398002 7:100321946-100321968 GTTTCTATAAAGCTGTGTGATGG + Exonic
1029754285 7:102563099-102563121 GTTTCTATAAAGCTGTGTGATGG + Intronic
1029772235 7:102662186-102662208 GTTTCTATAAAGCTGTGTGATGG + Intronic
1030640854 7:112004743-112004765 GTGTGTTTAGACCTGCGGGAGGG - Intronic
1032590105 7:133183940-133183962 GTGTGTATATATTTGGGGGAGGG - Intergenic
1035534245 8:378986-379008 GTGTCTGTAGGGCTGGGACAGGG - Intergenic
1036381596 8:8239453-8239475 GTGTCTGTTTGGCTGGGGGATGG - Intergenic
1038390598 8:27196812-27196834 GTGGTTAGAGGGCTGGGGGAGGG - Intergenic
1038983705 8:32786304-32786326 GTTTATATAGAGCGTGGGGAAGG + Intergenic
1041095796 8:54348317-54348339 GTGGTTATAGGGCAGGGGGAGGG - Intergenic
1045139401 8:99263580-99263602 CTGGCTTTAGAGATGGGGGAAGG - Intronic
1045443607 8:102238978-102239000 GAGTCCCTAGAGCTGGGGGCGGG - Exonic
1046723777 8:117652736-117652758 GTGTGTGTAGTGGTGGGGGATGG - Intergenic
1048035262 8:130671996-130672018 GTGTGGAAAGATCTGGGGGAAGG + Intergenic
1050120521 9:2302730-2302752 GAGCCTATAGAGCTGGAGCAAGG - Intergenic
1053001061 9:34577676-34577698 GTGTCCATTGGCCTGGGGGAGGG - Intronic
1055456564 9:76477793-76477815 TTGTTTCCAGAGCTGGGGGAGGG - Intronic
1056154079 9:83817627-83817649 GTGTCGGCAGAGCTGGGGGCAGG + Exonic
1056356419 9:85805466-85805488 GTGTCGGCAGAGCTGGGGGCAGG - Intergenic
1056435150 9:86568724-86568746 GGGTCTCAACAGCTGGGGGATGG + Intergenic
1056555580 9:87684611-87684633 GTGGCTGTTGAGCTGTGGGAAGG + Intronic
1057727121 9:97575521-97575543 GTGTGTAAACAGCTGGGAGATGG + Intronic
1062087194 9:134654941-134654963 GGGTGTGTAGAGCTGGGGGAGGG + Intronic
1188458541 X:30395484-30395506 GTGTCTATAGACAGAGGGGAAGG + Intergenic
1189315923 X:40056485-40056507 GTGTCCATGGAGCTGGGGGTTGG + Intronic
1190404016 X:50068232-50068254 GTGTGTGTGGAGGTGGGGGAGGG - Intronic
1192423481 X:71054420-71054442 GTGTGTGTAGAGATGGGGGAGGG - Intergenic
1194653864 X:96547881-96547903 GTGTGTGTGTAGCTGGGGGAAGG - Intergenic
1195328354 X:103776327-103776349 GTGTTCGTAGAGCTGGGGGTGGG + Intronic
1196669276 X:118348049-118348071 GTGTGTATTGGGGTGGGGGAGGG + Intronic