ID: 909703644

View in Genome Browser
Species Human (GRCh38)
Location 1:78554388-78554410
Sequence TCCCACTAGCTCCCAAGTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909703642_909703644 4 Left 909703642 1:78554361-78554383 CCAGAATGTTTTGTTAACTCCAA No data
Right 909703644 1:78554388-78554410 TCCCACTAGCTCCCAAGTAATGG No data
909703641_909703644 20 Left 909703641 1:78554345-78554367 CCAGAAATACAAAAAGCCAGAAT No data
Right 909703644 1:78554388-78554410 TCCCACTAGCTCCCAAGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909703644 Original CRISPR TCCCACTAGCTCCCAAGTAA TGG Intergenic
No off target data available for this crispr