ID: 909714475

View in Genome Browser
Species Human (GRCh38)
Location 1:78691368-78691390
Sequence TTGTAGAAGCTGAGTGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909714470_909714475 16 Left 909714470 1:78691329-78691351 CCCAAGGAAGGAATGAGCAGAGA No data
Right 909714475 1:78691368-78691390 TTGTAGAAGCTGAGTGATGAAGG No data
909714468_909714475 18 Left 909714468 1:78691327-78691349 CCCCCAAGGAAGGAATGAGCAGA No data
Right 909714475 1:78691368-78691390 TTGTAGAAGCTGAGTGATGAAGG No data
909714469_909714475 17 Left 909714469 1:78691328-78691350 CCCCAAGGAAGGAATGAGCAGAG No data
Right 909714475 1:78691368-78691390 TTGTAGAAGCTGAGTGATGAAGG No data
909714471_909714475 15 Left 909714471 1:78691330-78691352 CCAAGGAAGGAATGAGCAGAGAA No data
Right 909714475 1:78691368-78691390 TTGTAGAAGCTGAGTGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909714475 Original CRISPR TTGTAGAAGCTGAGTGATGA AGG Intergenic
No off target data available for this crispr