ID: 909724941

View in Genome Browser
Species Human (GRCh38)
Location 1:78823366-78823388
Sequence GGGTGCTTTAAGTTTAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909724941_909724946 6 Left 909724941 1:78823366-78823388 CCCTTCTTAAACTTAAAGCACCC No data
Right 909724946 1:78823395-78823417 CCATCTTCACTCTCAGCTTATGG No data
909724941_909724947 26 Left 909724941 1:78823366-78823388 CCCTTCTTAAACTTAAAGCACCC No data
Right 909724947 1:78823415-78823437 TGGCCCTGCTTATTTCACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909724941 Original CRISPR GGGTGCTTTAAGTTTAAGAA GGG (reversed) Intergenic
No off target data available for this crispr