ID: 909726331

View in Genome Browser
Species Human (GRCh38)
Location 1:78840600-78840622
Sequence CTGTGGGAGCTCTTCGGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909726331_909726337 -2 Left 909726331 1:78840600-78840622 CCAACCCCGAAGAGCTCCCACAG No data
Right 909726337 1:78840621-78840643 AGCTGTTCCCATAGTAGCAGAGG No data
909726331_909726340 8 Left 909726331 1:78840600-78840622 CCAACCCCGAAGAGCTCCCACAG No data
Right 909726340 1:78840631-78840653 ATAGTAGCAGAGGTTGCTTCTGG No data
909726331_909726341 9 Left 909726331 1:78840600-78840622 CCAACCCCGAAGAGCTCCCACAG No data
Right 909726341 1:78840632-78840654 TAGTAGCAGAGGTTGCTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909726331 Original CRISPR CTGTGGGAGCTCTTCGGGGT TGG (reversed) Intergenic
No off target data available for this crispr