ID: 909728513

View in Genome Browser
Species Human (GRCh38)
Location 1:78865809-78865831
Sequence CCATATAACCTTCAGTTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909728513_909728519 19 Left 909728513 1:78865809-78865831 CCACCAAACTGAAGGTTATATGG No data
Right 909728519 1:78865851-78865873 TATATTTTCTTATTTTCTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909728513 Original CRISPR CCATATAACCTTCAGTTTGG TGG (reversed) Intergenic
No off target data available for this crispr