ID: 909731481

View in Genome Browser
Species Human (GRCh38)
Location 1:78896982-78897004
Sequence GCATTTAAACAGAGTGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 282}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909731481 Original CRISPR GCATTTAAACAGAGTGATGA GGG (reversed) Intronic
902885264 1:19400273-19400295 GCAGTTAAAGGGGGTGATGATGG + Intronic
903459549 1:23510904-23510926 ACATTTAAAAATAGTTATGATGG + Intronic
904744238 1:32701645-32701667 TCTTTTAAACAGAGAGAGGAGGG + Intronic
905349454 1:37334747-37334769 GCATTTGAACAGGGTACTGAGGG - Intergenic
905845448 1:41227364-41227386 AAATTTAAACAGAGTGACTATGG - Intronic
906100926 1:43260868-43260890 ACATTTTTACAGAGTGCTGATGG - Intronic
906783682 1:48595573-48595595 TAATTAAAACAGAATGATGAAGG + Intronic
907708979 1:56860185-56860207 GCATTTAAACTGAGATGTGAAGG + Intronic
907943409 1:59110333-59110355 GCATTTGACCAGAGTTGTGAAGG - Intergenic
907984830 1:59520435-59520457 ACATTTAGACTGAGTGCTGATGG - Intronic
908589766 1:65617780-65617802 TCATTTAAACAGAGAGATATGGG - Intronic
908629942 1:66092718-66092740 GCATTTAAGCTGAGAGATGAAGG + Intronic
908849170 1:68356873-68356895 GCATTTAAACAAAGACCTGAAGG - Intergenic
909731481 1:78896982-78897004 GCATTTAAACAGAGTGATGAGGG - Intronic
909858592 1:80574258-80574280 GAATTTAATCAGAGTGTTTAGGG + Intergenic
909916313 1:81324016-81324038 GAATTTAAGCAGAGTGAGGCAGG + Intronic
910411714 1:86953459-86953481 TGATTTAAAGTGAGTGATGAGGG + Intronic
910617854 1:89219081-89219103 CCATTTTTACAGAGTGCTGATGG + Intergenic
910617859 1:89219146-89219168 CCATTTTTACAGAGTGCTGATGG + Intergenic
910898740 1:92096308-92096330 GCATTTAAGCTGAGTAAGGAGGG - Intronic
912012754 1:104989794-104989816 GAATTTAAACAGAGGTATCAAGG + Intergenic
914948256 1:152086048-152086070 CCATTCACACAGAGTGATGAGGG - Exonic
916839568 1:168585584-168585606 ACATTTGAACAGACTGCTGAGGG + Intergenic
916869109 1:168893280-168893302 TCAGATAAACAGAGAGATGAAGG + Intergenic
917427751 1:174933289-174933311 GCATTTTAACAGGGTGAAGAGGG - Intronic
918319996 1:183355175-183355197 GCATTTGAACAGAGCCTTGAAGG - Intronic
918929665 1:190838060-190838082 GCAGTTGAACTGAGTGTTGAAGG - Intergenic
919012646 1:191984911-191984933 GCAAATAAACAGAGACATGAAGG + Intergenic
919522291 1:198603000-198603022 GAATTTGAAGAGGGTGATGAGGG - Intergenic
921174788 1:212584614-212584636 GCATTTAAACTGATGGATCAAGG - Intronic
921302720 1:213765895-213765917 TAATTTAAACCAAGTGATGATGG + Intergenic
923452742 1:234135082-234135104 GCATTTAAACAGGCTGATCAGGG + Intronic
924311496 1:242748108-242748130 GCATTTAAAAAGAAAGATGAAGG - Intergenic
924322842 1:242866791-242866813 TCATTTAAACAGAGAGAAAAAGG + Intergenic
924790038 1:247237560-247237582 ATTTTTAAACAGGGTGATGAGGG - Intergenic
1064426264 10:15232327-15232349 ACAATTAAGCAGAGTGATGGTGG - Intronic
1064661387 10:17611390-17611412 GCATTTAAACTGAGCGGTGAAGG - Intronic
1064969023 10:21044705-21044727 GCATTTGAGCAGGGTGATAAAGG - Intronic
1066232131 10:33446109-33446131 GCATATAAACTGAAGGATGATGG - Intergenic
1067720587 10:48724986-48725008 GCATTTAACCAGAGAGCTGAGGG + Intronic
1067731242 10:48812939-48812961 GCATCTAAGCTGAGTGCTGAGGG - Intronic
1067810442 10:49422773-49422795 ACATTTAAACAGTGTGTAGAGGG - Intergenic
1069411612 10:68160109-68160131 CCATTTAAACTGAGAGATGCCGG + Intronic
1071156403 10:82694104-82694126 GCGTTTTTACAGAGTGCTGATGG + Intronic
1071156410 10:82694236-82694258 GCGTTTTTACAGAGTGATGATGG + Intronic
1072429559 10:95358888-95358910 ACAATGAAACAGAGGGATGAAGG - Intronic
1072466561 10:95668551-95668573 TCATTTAAGCATAATGATGATGG + Intronic
1072710305 10:97712182-97712204 GCATTTAAACTGAGCCTTGAAGG + Intergenic
1073029251 10:100511799-100511821 GAAGTCAAACAGAGTGATTAAGG + Intronic
1073088900 10:100915930-100915952 CCATTTAATCTGAGTTATGAAGG + Intronic
1074228247 10:111508442-111508464 GCATGTAAACAGAGTGACCCTGG - Intergenic
1074316506 10:112366310-112366332 GCTTGGTAACAGAGTGATGACGG - Intergenic
1074401301 10:113143041-113143063 GAATTAAAACAGAGTAATGGAGG - Intronic
1076414628 10:130277066-130277088 GGATTTAAACAGTGGGAAGATGG + Intergenic
1079057342 11:17217692-17217714 ACATTTAACCAGAGATATGAAGG - Intronic
1079875191 11:25847504-25847526 GTATTTAAACAGAGACCTGAAGG + Intergenic
1083157280 11:60831688-60831710 TCATTTCAACTGAGTGAGGATGG + Intergenic
1083806256 11:65075999-65076021 GCTGTTAAAGAGAGTGACGAGGG + Intronic
1085370562 11:76000095-76000117 GCATTTAAAAAGAGAGAGAAAGG + Intronic
1085956090 11:81397120-81397142 TCATTAAAACAGATTGCTGATGG - Intergenic
1086487396 11:87322184-87322206 GCATATAAACTGAGCTATGAAGG - Exonic
1086859905 11:91913610-91913632 GCATGTAAGCTGAGTGAGGAAGG + Intergenic
1088469050 11:110174966-110174988 ACATGAAAGCAGAGTGATGAAGG - Intronic
1089430987 11:118424324-118424346 CTATTTGAACAGAGTGTTGAAGG - Intronic
1089431226 11:118426214-118426236 ACATTTAAACAGAGATCTGAAGG + Intronic
1090001757 11:122967086-122967108 GCATTTACAGTGAGTGATGGAGG - Intergenic
1090108497 11:123877856-123877878 GCATTTTAACAGAGAAATAAAGG - Intergenic
1091171655 11:133525231-133525253 GCATTTAAGCTGAGTTCTGAAGG + Intronic
1091671561 12:2455833-2455855 GCAACAAAACAGACTGATGAGGG - Intronic
1091760197 12:3082246-3082268 GCATTTCAACAGAAGGAGGAAGG + Intronic
1092486144 12:8903541-8903563 GAATTTTAACAGAGTGGTCAGGG - Intergenic
1092976078 12:13746139-13746161 CCTTTTAAACAGAGTGATCAGGG + Intronic
1093815911 12:23546366-23546388 GCAGTTAAACAGAATGAAGAAGG - Exonic
1093975904 12:25421818-25421840 CCATTTAATCCAAGTGATGAAGG - Intronic
1094597162 12:31875799-31875821 GCATCTTAACAAAATGATGAAGG - Intergenic
1097794326 12:63845225-63845247 CCATTTAAAAAGAATAATGATGG - Intronic
1099360984 12:81701357-81701379 GCATTTAGAGAGAGTTATGAGGG + Intronic
1099550361 12:84035962-84035984 TCATTTAAAGAGAATGATAAAGG + Intergenic
1102625189 12:114229121-114229143 GCAACTAAACTCAGTGATGATGG + Intergenic
1104321416 12:127755043-127755065 GCATTTAAACAAAGATCTGAAGG + Intergenic
1105985758 13:25565068-25565090 ACATATAAAGAGAGAGATGATGG - Intronic
1107331571 13:39306951-39306973 GCATTTAAACAGACAGAGGCTGG - Intergenic
1108002174 13:45914263-45914285 TCATTTTAATAGAATGATGATGG - Intergenic
1109205866 13:59482070-59482092 GAATTTAAGTAGAATGATGAGGG + Intergenic
1109939225 13:69338105-69338127 TCACTTAACCAGAGTGATGAAGG + Intergenic
1110243229 13:73291813-73291835 GCTTTCCAACAGTGTGATGATGG + Intergenic
1110474442 13:75897437-75897459 GCAGTCAAACAGAGGGATGTGGG + Intergenic
1111760831 13:92462117-92462139 GCATTTAATCAGAGTGACAGCGG + Intronic
1112946070 13:104928580-104928602 GAATTTACACTGAGGGATGATGG - Intergenic
1113716736 13:112514504-112514526 GCTTTTAAAATGATTGATGAGGG - Intronic
1114341197 14:21746398-21746420 GGAAGTAAACAGAATGATGAAGG + Intergenic
1114616444 14:24071260-24071282 ACATTCAAACAGAGAAATGATGG - Intronic
1115194675 14:30783647-30783669 ACATTTAACCAGTGTGAGGAAGG + Intergenic
1115539935 14:34411096-34411118 TTATTTAAATAGAGTGAAGAAGG + Intronic
1116305256 14:43245811-43245833 GCGTTTTTACAGAGTGCTGATGG - Intergenic
1117015750 14:51515249-51515271 GCATTCAGACACAGGGATGAAGG - Intronic
1117887909 14:60384633-60384655 ACATTTAAACAGTGTGTAGAGGG + Intergenic
1121805967 14:96823084-96823106 GCAGTGAAACAGAGTGGTCATGG - Intronic
1125425840 15:39548647-39548669 GCATATGAACAGAGTAATCATGG + Intergenic
1125729436 15:41884682-41884704 GCTTTTACTCAGAGAGATGATGG - Intronic
1126658945 15:51012321-51012343 GCCTTGCAGCAGAGTGATGATGG - Intergenic
1126718645 15:51551969-51551991 GTATTTAAACTGAGAGTTGAAGG + Intronic
1127665311 15:61140403-61140425 GCATTTAAACTGAGTCTTTAAGG - Intronic
1128280949 15:66393845-66393867 ACATTTCAACAGAGGGGTGAAGG - Intronic
1130688176 15:86057290-86057312 GATTTTAAACAGGATGATGATGG - Intergenic
1130823559 15:87520111-87520133 GCATTTTAACAGACAAATGATGG - Intergenic
1134365531 16:13574225-13574247 TTATTTAAATAGAGGGATGAGGG - Intergenic
1137622837 16:49887630-49887652 GCATTTTGGCAGAGTGAGGAGGG + Intergenic
1139722703 16:68869746-68869768 GCATTTAAACTGAGCCCTGAAGG + Intronic
1140181284 16:72721498-72721520 CCATTTTGACAGAGTAATGATGG + Intergenic
1142888459 17:2927969-2927991 GCATTTCCACAGAGAGAAGAGGG + Intronic
1143528864 17:7488924-7488946 CTATTTAAACAGAGTGGTCAGGG - Intronic
1145016541 17:19402511-19402533 GCATGTACCCAGAGTGATGCTGG - Intergenic
1146591113 17:34128672-34128694 TCATTTAAAGAGAGTGCTGGAGG - Intronic
1148747200 17:49924986-49925008 GGATGCAAACTGAGTGATGAGGG + Intergenic
1152024337 17:77798953-77798975 GCCTTTTGACAGAGTCATGAGGG - Intergenic
1153213814 18:2798003-2798025 GCATTGAAACAGAGAACTGAAGG + Intronic
1153306423 18:3635764-3635786 CTATTTAAACATAGTTATGAGGG - Intronic
1153835096 18:8956556-8956578 TCAGTTGAACAGAGGGATGATGG - Intergenic
1154411255 18:14143390-14143412 GCATTTAAATAGAGGCAGGATGG - Intergenic
1156915037 18:42455741-42455763 ACATTTAAACAGAATTAGGAAGG + Intergenic
1157599220 18:48883512-48883534 GCATTTAAGCAAAATGTTGATGG + Intergenic
1157893502 18:51441698-51441720 GCATTTGGACAAAGTTATGAGGG - Intergenic
1159039906 18:63314722-63314744 GAATTTAAACTGTGTTATGAGGG + Intronic
1159480554 18:68985837-68985859 GCAATGAAACAGAGTGGAGAAGG + Intronic
1161303859 19:3556470-3556492 GCAGTTAAACAGACAGATGGGGG + Intronic
1162360876 19:10219796-10219818 GCATTTGAGCAGAGTCCTGAAGG + Intronic
1162791384 19:13064778-13064800 GCATTTGAACAGAGTTGAGAAGG + Intronic
1164659552 19:29950751-29950773 GCATTGAAAGAGAGTTATAAAGG - Intronic
1164866398 19:31607705-31607727 TCAATTAAACACAGTGATGGAGG + Intergenic
1164898697 19:31899650-31899672 GCCTTGAAAGACAGTGATGAGGG - Intergenic
926408997 2:12582221-12582243 GCCTTGAAAGACAGTGATGAGGG + Intergenic
927279535 2:21291908-21291930 GCATTTGAACTGAGAAATGAAGG - Intergenic
931926560 2:67079606-67079628 GCCTTTAAAAATAGTGATTAGGG + Intergenic
932735080 2:74248666-74248688 GGAATTAAACAGAGTGACAATGG - Intronic
933016826 2:77138461-77138483 ACATTTAAACAGTGTGTAGAGGG + Intronic
935035727 2:99370863-99370885 GCATTGACCCAGAGTGATGGTGG + Intronic
938542540 2:132296430-132296452 GCACTGAAAGAGAGTGATGCTGG - Intergenic
938779509 2:134572618-134572640 GCATTTAGACCTATTGATGATGG - Intronic
939868216 2:147498751-147498773 ACAGTTTAACAGAGTGAAGAGGG + Intergenic
943086015 2:183312179-183312201 GGAGATAAACACAGTGATGACGG + Intergenic
943139842 2:183968504-183968526 GCATTTAAATAGATTGATAATGG + Intergenic
944053082 2:195493509-195493531 GCGTTTTTACAGAGTGCTGATGG - Intergenic
945367204 2:208969381-208969403 TCATTACAACAGAGTGATCAAGG + Intergenic
945532779 2:210976828-210976850 GCATTTACTCAGAGTGATTTAGG + Intergenic
945624749 2:212188713-212188735 GTATTTAAACTGAGTTCTGAAGG - Intronic
945829893 2:214771067-214771089 GCATTTATGCAGCGGGATGAAGG + Intronic
947063689 2:226195990-226196012 GCTTTTAGAAAGAGTAATGATGG + Intergenic
947775820 2:232708513-232708535 GCTTTTGAACAGAGAGATGTGGG + Intronic
1169959684 20:11145430-11145452 GCACTTAAACAGACTGAAGGGGG + Intergenic
1170165197 20:13354760-13354782 GCATCAAAACAGGGTGATGGAGG + Intergenic
1170706224 20:18746874-18746896 GCAGGAAAACACAGTGATGAGGG - Intronic
1171871419 20:30529277-30529299 GCACTGAAAGAGAGTGATGCTGG - Intergenic
1172529127 20:35618261-35618283 GGATATAAACAGACTTATGAGGG + Intronic
1172606405 20:36217093-36217115 TGATGTAAACAGAGTGATGGGGG + Intronic
1172632191 20:36385981-36386003 GCACTAAAGCAGAGTGAAGAAGG + Intronic
1173367196 20:42396918-42396940 GCATTTGAACAGAGACCTGAGGG - Intronic
1174584952 20:51601283-51601305 GCAGCTGACCAGAGTGATGACGG + Exonic
1175672057 20:60911981-60912003 GCATTTAAAAATAATGAAGATGG + Intergenic
1176839819 21:13829399-13829421 TCAATGAAACAGAGAGATGAAGG - Intergenic
1176861802 21:14015027-14015049 GCATTTAAATAGAGGCAGGATGG + Intergenic
1177252648 21:18614396-18614418 GCACTTACACACAGTAATGAAGG + Intergenic
1178096167 21:29218004-29218026 GCATTTGAACTGAATCATGAGGG - Intronic
1179227785 21:39470598-39470620 ACATGTAAACAGAGTGATTAGGG - Intronic
1181294353 22:21823489-21823511 GCATTTAAACAGAGAACTGAAGG + Intronic
1182595196 22:31414095-31414117 ACATTTAAAGAGTCTGATGATGG - Intronic
1183779708 22:39991210-39991232 ACATTGAAACAGAATGATTAAGG - Intergenic
1184232374 22:43165444-43165466 GCTTCTTAACACAGTGATGAGGG + Intergenic
1184584041 22:45435708-45435730 GCATATAAACGAAGTGGTGATGG - Intergenic
1184834915 22:47015379-47015401 TCATTTAAACAGAGGGCCGAAGG - Intronic
949265478 3:2152114-2152136 GCATTTAAACAAAGTATTGAAGG + Intronic
949916344 3:8967536-8967558 GCATTAAGAAAGAGTGATTATGG - Intergenic
952525611 3:34207314-34207336 ACATTTAAGCAGAGAGCTGAAGG - Intergenic
953271772 3:41452456-41452478 GCAATTAAACAGTGTAATCAGGG + Intronic
955624102 3:60898333-60898355 GCATTTGAACAAATTCATGAAGG - Intronic
956639141 3:71398488-71398510 GAATTTAAACAGGGTGAAAAGGG - Intronic
957686816 3:83513208-83513230 GGTTTTCAGCAGAGTGATGAAGG + Intergenic
958950108 3:100407102-100407124 GCATTTAAATACTGTAATGAGGG - Intronic
959084766 3:101840055-101840077 GCCTTAAAACAGAATGGTGAAGG - Intronic
959346060 3:105196051-105196073 TCCTTTGAACAGAGTGGTGAGGG + Intergenic
959682839 3:109115933-109115955 GTATTTAAACTGAGTCCTGAAGG + Intronic
960098373 3:113710258-113710280 GAATTTAAATAGACTGATCATGG - Intergenic
960986048 3:123281722-123281744 TCATTTAATCATACTGATGAAGG - Intergenic
961339021 3:126205002-126205024 CATTTTAAACAGAGTGGTGAGGG + Intergenic
962200009 3:133393195-133393217 GCATTTGAACAGAGACCTGAAGG - Intronic
963326646 3:143870346-143870368 GCATTTATACAGAGTATTTAAGG - Intergenic
963378139 3:144495650-144495672 GCATGAAAACAGACTGTTGATGG - Intergenic
964664214 3:159154293-159154315 GCATGGACACAGAATGATGAAGG + Intronic
965078374 3:164006127-164006149 GCATTTAAACATAGGAATTAAGG + Intergenic
965154505 3:165030235-165030257 TCATTTTAACAAAATGATGATGG - Intronic
970093086 4:12431354-12431376 TAATTTAAAGAGAGTGATGGGGG + Intergenic
970212176 4:13721121-13721143 GCATTTAAGCATAGTGGTAACGG - Intergenic
970503529 4:16703266-16703288 ATATTTAAGCAGAGTCATGAAGG + Intronic
970852870 4:20622773-20622795 ACATTTAAACCAAGTCATGAAGG + Intergenic
974891094 4:67884391-67884413 GCATTTAATCATACAGATGAGGG - Intergenic
975436191 4:74354815-74354837 ACATCTAAACACAGGGATGATGG + Intergenic
977684323 4:99830584-99830606 GAATTCAAAGTGAGTGATGAAGG - Intronic
978219921 4:106257549-106257571 TCATTTTAATAGAATGATGATGG + Intronic
978461436 4:108957835-108957857 CTATTTTAAAAGAGTGATGAGGG - Intronic
978652530 4:111024016-111024038 GCTTTAAGGCAGAGTGATGAAGG + Intergenic
978962123 4:114692881-114692903 GCATTTAGACAGAGGCCTGAAGG - Intergenic
979132154 4:117060557-117060579 GAAGGTAAACAGAGTGATGAAGG - Intergenic
979396119 4:120191617-120191639 GCATAAAAACAGAGTGTTGTGGG + Intergenic
979478456 4:121185976-121185998 TCATTTGGACAGAGTGGTGAAGG + Intronic
980545334 4:134254460-134254482 ATATTTAAAAAGAGTGAAGAAGG - Intergenic
984346627 4:178536590-178536612 GAATTTCAACAAAGGGATGAAGG + Intergenic
987367793 5:17164833-17164855 ACATTGAAACAGAAGGATGATGG + Intronic
988197269 5:28020475-28020497 ACATTTAAACAGAGATATAAAGG + Intergenic
989447362 5:41546005-41546027 GCATAAAATCAGAGAGATGAAGG + Intergenic
989972729 5:50544049-50544071 GCATTCAAACAGGGTGTAGAGGG + Intergenic
991916139 5:71607728-71607750 GCATTCAAACAGTGTGTAGAGGG - Intronic
993285067 5:85984724-85984746 CAATTTAAACTGAGTGATTATGG + Intergenic
994302941 5:98167713-98167735 GAAATTAAATAGAATGATGAAGG + Intergenic
994844944 5:104976777-104976799 GCATTTAAAGATAGGGCTGATGG + Intergenic
995036736 5:107542909-107542931 GCATTTGAACCGAGTGATTCCGG - Intronic
996238093 5:121158823-121158845 GCATTTAAAAAGCCTGATGCAGG - Intergenic
996723987 5:126657821-126657843 GCTTTTTAACAGAAAGATGAAGG - Intergenic
999383301 5:151136948-151136970 ACAGATAAACACAGTGATGATGG - Intronic
999729219 5:154463206-154463228 GCATTGCAACAGAGTGCTTAGGG - Intergenic
1002015989 5:176323232-176323254 GCATTTGGACAGATTGAGGAAGG + Intronic
1002330973 5:178440384-178440406 GCATTTGCCCAGAGTGTTGAAGG - Intronic
1002410511 5:179071149-179071171 GCATTTAAAAAAAGAGATCAGGG - Intronic
1002448571 5:179306335-179306357 GCATATTAACAGACTGAAGAAGG + Intronic
1002529577 5:179836062-179836084 GCATTGAAATAGATTGAAGATGG - Intronic
1002987083 6:2200930-2200952 GCATGTTAGCAGAGAGATGAAGG + Intronic
1003939384 6:11009203-11009225 GGGTTGAAACAGAATGATGAGGG + Intronic
1004097310 6:12570084-12570106 GCATTTATACAGAATAATAATGG - Intergenic
1004128096 6:12893393-12893415 GCATTTAAAAAAATTGTTGATGG - Intronic
1007569128 6:42876615-42876637 AATTTTAAGCAGAGTGATGATGG - Intergenic
1008860147 6:56139127-56139149 GCACTTCAACAGAGAGAGGAAGG + Intronic
1009702270 6:67200557-67200579 GGAATTCAACAGAGTGGTGATGG + Intergenic
1009907033 6:69883056-69883078 ACATTTAAGCAGAGGCATGAAGG + Intronic
1009970259 6:70617955-70617977 CCCTTTAAACAGTGAGATGATGG + Intergenic
1010109784 6:72212997-72213019 TGATATAAGCAGAGTGATGAAGG + Intronic
1012077332 6:94707026-94707048 GCATTTCAGGAGAATGATGAGGG + Intergenic
1012310906 6:97722889-97722911 GCTTTGAAACAAAATGATGAAGG + Intergenic
1012859622 6:104543960-104543982 CCATTCAAATAGAGTGATTATGG + Intergenic
1013587727 6:111594539-111594561 GGCTTTAAAAAAAGTGATGAGGG + Intronic
1013936404 6:115600696-115600718 GAATTTAAGCAGAATGATCAAGG + Intergenic
1013950387 6:115773532-115773554 GCATTTTAAAAGAGCTATGATGG - Intergenic
1014108507 6:117593833-117593855 GGATTGGAACAGAGGGATGAGGG - Intronic
1014675217 6:124355962-124355984 GCATTCTAACAGAAGGATGATGG - Intronic
1015721729 6:136249816-136249838 TCATTTTAAAAGAGTGAGGAGGG - Intronic
1017840388 6:158217501-158217523 ACCTTTAAATAAAGTGATGAGGG - Intergenic
1018777225 6:167028775-167028797 GCAGTAAAACACAGTGGTGAGGG - Intronic
1023181836 7:37492451-37492473 CCATTTTCACAGAGTGCTGATGG - Intergenic
1023949432 7:44830586-44830608 GCACTTAAGCAGAGAGAAGAAGG - Intronic
1025033953 7:55580327-55580349 ACATTTAAACAGTGTGTAGAGGG - Intergenic
1026473591 7:70715407-70715429 GCATTTGAACAGAGCTATGAAGG - Intronic
1027647111 7:80815599-80815621 GATATAAAACAGAGTGATGAAGG + Intronic
1028382761 7:90216861-90216883 GTTTTAAAACACAGTGATGACGG - Intronic
1028631717 7:92942341-92942363 ACATTTTAACTGACTGATGATGG - Intergenic
1029009884 7:97248494-97248516 GGAGCTAAACAGAGGGATGATGG + Intergenic
1031565044 7:123285488-123285510 GCATTTGAAAAGTGTGTTGATGG + Intergenic
1032210337 7:129908443-129908465 GCATTTCAATAGAGTAAAGAGGG + Intronic
1036198908 8:6749794-6749816 GCATTTAAACAAGGTTATTATGG - Intronic
1036972469 8:13370143-13370165 GCCTTTAGACAAAGTGATCAAGG - Intronic
1037008677 8:13813376-13813398 CCAGTGAAACAAAGTGATGATGG + Intergenic
1038094907 8:24297548-24297570 GCATTTAAAAAGATTTATGTTGG + Intronic
1039044799 8:33440051-33440073 GACTTTAGACAGAGTGATCAGGG - Intronic
1039774793 8:40724728-40724750 GCATTTGAACTGAGTCTTGAAGG + Intronic
1040625425 8:49143599-49143621 ACATTAAAACAGTGTGGTGAAGG + Intergenic
1042657925 8:71120713-71120735 GCATTTAAACATATAGATCAAGG + Intergenic
1043959041 8:86394380-86394402 ACATTTAAACTAAGTGATTAAGG - Intronic
1044073354 8:87789300-87789322 GCTGTTAAACAGAATGAAGAAGG - Intergenic
1044564653 8:93649771-93649793 GCATTTAAACAGAGATGTCAGGG + Intergenic
1045242415 8:100414277-100414299 GCATGTAAATAGAGTAAGGAAGG + Intergenic
1045646203 8:104301667-104301689 GTAATTAAAAAGAGTGATGTTGG + Intergenic
1046645429 8:116780863-116780885 CCATTAAAATAGAGTGATGAGGG - Intronic
1046926005 8:119789554-119789576 GCAGTTCAACAGAGTGGGGAAGG - Intronic
1047419284 8:124693104-124693126 GCATACAAACAGGGTGAAGAAGG + Intronic
1048190116 8:132280665-132280687 ACATTTAAGCTGAGAGATGAGGG + Intronic
1050628326 9:7532290-7532312 ACATTTAAACTGAGATATGAAGG - Intergenic
1052884576 9:33632083-33632105 CGATTTCAACATAGTGATGAAGG - Intergenic
1053285885 9:36849275-36849297 CCTTTTAAACACAGTGATCAGGG - Intronic
1054380328 9:64484338-64484360 TCAATGAAACAGAGAGATGAAGG + Intergenic
1055247590 9:74265461-74265483 GAATTTTAACAGACTGATTAAGG + Intergenic
1055495098 9:76846305-76846327 GCATTTAAAAATAGGCATGAGGG - Intronic
1055835422 9:80434863-80434885 GAATTTCAACAGAATTATGATGG + Intergenic
1056211298 9:84367663-84367685 GCAGGAGAACAGAGTGATGATGG + Intergenic
1059722502 9:116975028-116975050 GCATTGAGACACAGTGATGGAGG + Intronic
1059847963 9:118302652-118302674 GGCTTTAAACAAAGTGAGGAAGG + Intergenic
1060386092 9:123230089-123230111 GAATTTAAGCTGAGTGAGGAAGG + Intronic
1061633817 9:131892393-131892415 GCAATTAAATAGAGTGTTAAAGG + Intronic
1186062197 X:5721215-5721237 GCATTTAAACTTTGAGATGAGGG + Intergenic
1186312645 X:8337493-8337515 GAATTTAAACTTAGTGATAAAGG - Intergenic
1186603981 X:11069896-11069918 GCATTTAAAGAGAGGGAAAAAGG - Intergenic
1187520214 X:20006367-20006389 GCATTTAAATAAAGTTATAATGG - Intergenic
1188209235 X:27399435-27399457 GAATTTAAAAAGAGTCAGGAGGG + Intergenic
1189558350 X:42167813-42167835 GCTTTTACTCAGAGTGATTATGG + Intergenic
1189670529 X:43403832-43403854 GCATTTGAGCAGAGACATGAAGG + Intergenic
1189853544 X:45200454-45200476 CCATTTAATCAGAGTGGTAATGG - Intronic
1190736698 X:53260200-53260222 GCATATAAGCAGAGTGCTGAGGG + Intronic
1191046461 X:56143280-56143302 GCATTTAAGCAGAGACATAAAGG - Intergenic
1192555235 X:72084019-72084041 CCATTTAAACTGAGTCTTGAAGG - Intergenic
1192633887 X:72800470-72800492 GCATTTTAAAAGAGGGAAGAAGG - Intronic
1192647823 X:72920331-72920353 GCATTTTAAAAGAGGGAAGAAGG + Intronic
1193224252 X:78963211-78963233 TCATTTGAACAGAGTGACTATGG + Intergenic
1194565862 X:95487076-95487098 GCAGATAAACAGAGTGCTCATGG + Intergenic
1197368361 X:125595328-125595350 GTATTGAATAAGAGTGATGAAGG - Intergenic
1197387574 X:125820476-125820498 GCATGTAAACAGACTAATGCAGG - Intergenic
1199341268 X:146679993-146680015 GAATTTAAGCTGAGTAATGAGGG - Intergenic
1200378737 X:155811785-155811807 ACATTTAAACAGTGTGTAGAGGG + Intergenic
1201258513 Y:12134375-12134397 GCATTTTTACAGAGTGCTGATGG - Intergenic