ID: 909732245

View in Genome Browser
Species Human (GRCh38)
Location 1:78907780-78907802
Sequence GCAGCCAGTGTGACTGAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909732244_909732245 -5 Left 909732244 1:78907762-78907784 CCTCTTAGGAAGTGTCAAGCAGC 0: 1
1: 0
2: 0
3: 6
4: 79
Right 909732245 1:78907780-78907802 GCAGCCAGTGTGACTGAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909732245 Original CRISPR GCAGCCAGTGTGACTGAATA TGG Intronic
No off target data available for this crispr