ID: 909733641

View in Genome Browser
Species Human (GRCh38)
Location 1:78929174-78929196
Sequence TTTTAGAAGAGTAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 586
Summary {0: 1, 1: 0, 2: 1, 3: 52, 4: 532}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909733641_909733647 21 Left 909733641 1:78929174-78929196 CCTTCCTCCTTACTCTTCTAAAA 0: 1
1: 0
2: 1
3: 52
4: 532
Right 909733647 1:78929218-78929240 CATTTAAAAATCCAGGGGCCAGG 0: 1
1: 0
2: 0
3: 27
4: 365
909733641_909733645 15 Left 909733641 1:78929174-78929196 CCTTCCTCCTTACTCTTCTAAAA 0: 1
1: 0
2: 1
3: 52
4: 532
Right 909733645 1:78929212-78929234 AATATACATTTAAAAATCCAGGG 0: 1
1: 0
2: 7
3: 113
4: 877
909733641_909733646 16 Left 909733641 1:78929174-78929196 CCTTCCTCCTTACTCTTCTAAAA 0: 1
1: 0
2: 1
3: 52
4: 532
Right 909733646 1:78929213-78929235 ATATACATTTAAAAATCCAGGGG 0: 1
1: 1
2: 6
3: 67
4: 632
909733641_909733648 29 Left 909733641 1:78929174-78929196 CCTTCCTCCTTACTCTTCTAAAA 0: 1
1: 0
2: 1
3: 52
4: 532
Right 909733648 1:78929226-78929248 AATCCAGGGGCCAGGCACAGTGG 0: 2
1: 12
2: 121
3: 750
4: 4141
909733641_909733644 14 Left 909733641 1:78929174-78929196 CCTTCCTCCTTACTCTTCTAAAA 0: 1
1: 0
2: 1
3: 52
4: 532
Right 909733644 1:78929211-78929233 AAATATACATTTAAAAATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909733641 Original CRISPR TTTTAGAAGAGTAAGGAGGA AGG (reversed) Intronic
900675707 1:3884471-3884493 ATTTAGAAGAGTCAAGAGGATGG - Exonic
901186595 1:7377387-7377409 ATAGAGAACAGTAAGGAGGAGGG - Intronic
903052363 1:20611296-20611318 GTCCAGAAGAGTAAGAAGGATGG + Intronic
903971040 1:27118974-27118996 TTTTAGAAGAGGCTGGGGGATGG + Intronic
904087196 1:27917146-27917168 TTTTTAAAGAGGAAGGAGGAAGG - Intergenic
904112425 1:28136676-28136698 TCTTAGAAGAGTGAAGAGAAGGG + Intergenic
904232708 1:29089887-29089909 TTTGAGATGAGAAAGAAGGAAGG + Intronic
905140597 1:35840856-35840878 CTTTAGAAGGCCAAGGAGGAAGG - Intronic
905970189 1:42135979-42136001 TTGTAGAACAGAAAGGAAGAAGG - Intergenic
908641960 1:66234038-66234060 TTTTAGAAAATTGAAGAGGAGGG - Intronic
909173746 1:72327474-72327496 ATTCTGAAAAGTAAGGAGGAGGG - Intergenic
909253659 1:73390571-73390593 AGTTAGAAGAAGAAGGAGGAAGG - Intergenic
909281293 1:73756971-73756993 TTTGAAAAGAGAAAGAAGGATGG - Intergenic
909733641 1:78929174-78929196 TTTTAGAAGAGTAAGGAGGAAGG - Intronic
910404402 1:86871961-86871983 TTTTAAAAGATTCTGGAGGAGGG + Intronic
910654132 1:89602964-89602986 AGTGAGAAGAGTGAGGAGGAGGG + Intergenic
910769813 1:90819635-90819657 ATTTACAAGAGTAAGCATGACGG - Intergenic
911406204 1:97443320-97443342 TTTTGGCAAAGAAAGGAGGATGG + Intronic
911717415 1:101149613-101149635 TTGTAGTAAAGAAAGGAGGAGGG + Intergenic
911779965 1:101864086-101864108 TGTTAGGAGAGTTAGGAGAAGGG - Intronic
912344101 1:108948060-108948082 TTTAACAAGAGAAAGAAGGAAGG + Intronic
912724337 1:112045394-112045416 TCTTAGAAGAATCAGGAAGATGG + Intergenic
913522578 1:119659784-119659806 TTGTAGAAGAGAGAGGGGGAGGG - Intronic
915090907 1:153425235-153425257 TTTGAAAAAAGCAAGGAGGATGG + Intergenic
915374779 1:155383986-155384008 TTTTAAAAGAGTAAATTGGATGG + Intronic
915541240 1:156567702-156567724 TCTTAAAGGAGTCAGGAGGATGG - Intronic
915893889 1:159796058-159796080 TTTGAGAAGAGGAATGAGTAGGG + Intergenic
916162643 1:161934245-161934267 TGTTAGAGGAGGATGGAGGAAGG - Intronic
917517096 1:175717277-175717299 TTCTAGTAGAGTAGGGAGGGAGG + Intronic
917546869 1:175979180-175979202 TTTTGGGGGAGGAAGGAGGAGGG - Intronic
918016345 1:180636753-180636775 TATTAGAAAAGTAAGGGGGCTGG + Intronic
918930817 1:190854649-190854671 TTTTAGAAAATAAAGGAAGAGGG - Intergenic
919112216 1:193235280-193235302 TTGGAGAAGAGAAAGGAGGAAGG - Intronic
919954477 1:202399448-202399470 TTTTAGGAAGGTAAGGAGGGAGG - Intronic
920291608 1:204927629-204927651 TTTGGGAAGGCTAAGGAGGAGGG - Intronic
920505770 1:206514168-206514190 TTTTTGGAGAGGAAGGAGGAAGG + Intronic
920559439 1:206928817-206928839 TTTTAGAATAAGGAGGAGGAGGG - Exonic
921114630 1:212077180-212077202 TTTCAAAAGAGCAAGGAGGTTGG - Intronic
921269890 1:213458146-213458168 TTGTAGAGGGGGAAGGAGGATGG - Intergenic
921758072 1:218882226-218882248 TATTAGAAGATCAAGGAGGCAGG - Intergenic
921990639 1:221362443-221362465 TTTTAGAAGAGGAACAAAGAAGG - Intergenic
922017934 1:221671088-221671110 TTGTGGAAGAGTAAGGATGCTGG - Intergenic
922486900 1:225980439-225980461 TACTAGAAGAGGAAGGAGGAAGG + Intergenic
922858598 1:228796075-228796097 GTGAAGAAGAGTATGGAGGATGG - Intergenic
923201726 1:231718892-231718914 TTTTAGAAGGCTGAGGTGGAAGG + Intronic
923468997 1:234273483-234273505 TTTTTGAAGAGGCAGCAGGAAGG + Intronic
924901991 1:248410996-248411018 ATTTGGAAGAGTTTGGAGGAGGG + Intergenic
924920010 1:248619147-248619169 TGTTAGAAGACAATGGAGGAGGG + Intergenic
1063286166 10:4691345-4691367 TTTTAGAAGATAAAGAAAGATGG + Intergenic
1063449121 10:6139775-6139797 TCCAAGAAGAGTGAGGAGGAGGG - Intergenic
1063759288 10:9054770-9054792 TTTTAAAACAGTGAAGAGGAGGG - Intergenic
1063761680 10:9085817-9085839 TTTTAGTAGTGTAAAAAGGATGG - Intergenic
1063793960 10:9488847-9488869 TTTTCGAAAAGTAAGGACAAAGG + Intergenic
1063819182 10:9814587-9814609 TTTTACAAGATTATGGATGATGG + Intergenic
1064934846 10:20668199-20668221 TTTTCAAAGAGTAAGTAGGATGG + Intergenic
1065371598 10:24992330-24992352 TTTTAGATAAATAAGGAGGTCGG + Intronic
1065735204 10:28745212-28745234 TGTTGGAAGAGCAAGGAGGCTGG + Intergenic
1066529028 10:36316119-36316141 ATTGAGGAGAATAAGGAGGAGGG - Intergenic
1067093773 10:43285314-43285336 TTCTAGAAGAGAGAGGAGGAGGG - Intergenic
1067895769 10:50177437-50177459 AATTAGAAGAGTTAGGAGAAGGG - Intergenic
1068462666 10:57347952-57347974 TTTTAAAAAATTGAGGAGGAGGG - Intergenic
1069027647 10:63561315-63561337 ATTTAGAAGTTTATGGAGGAAGG + Intronic
1069164693 10:65139200-65139222 TTTCAGAAAAGAAAGGATGAGGG - Intergenic
1069998344 10:72357174-72357196 TTTTAGAAAAGGAGGGAGGGGGG + Intergenic
1070404162 10:76079814-76079836 TTTTATAACAGTTAGGAGTAAGG + Intronic
1070718224 10:78738146-78738168 AGTTAGAAAAGTAAGGAGTAAGG + Intergenic
1070891026 10:79942342-79942364 TCTGAGAAGGGAAAGGAGGAAGG - Intronic
1071755919 10:88539073-88539095 TTCTAAAAGACTAAGGAAGATGG + Intronic
1072033189 10:91540657-91540679 TTGTAGAAGAGAATGTAGGATGG - Intergenic
1073049394 10:100657729-100657751 TTTGAGAACTGTATGGAGGATGG + Intergenic
1073167656 10:101471614-101471636 TTTTAGAAAACAGAGGAGGATGG - Intronic
1073383693 10:103103352-103103374 TTTAATAAAAGTAAGGTGGAAGG + Intronic
1073638300 10:105221897-105221919 TTAAAGAAGAGAAAGAAGGAGGG + Intronic
1074172434 10:110955862-110955884 TCGTTGAAGAGTTAGGAGGAAGG + Intronic
1074336011 10:112576314-112576336 TTTTAGAAGAGGCAGGGGGCCGG - Intronic
1074542387 10:114375728-114375750 TTTTTGAAGGATAAGGAGGGAGG + Intronic
1075328008 10:121550160-121550182 GTTTGGAAGAATAAGGAGAAAGG - Intronic
1075394221 10:122114860-122114882 TTTTAAGAGAGAAAAGAGGACGG - Intronic
1075496681 10:122926804-122926826 TTTCAAAAGATAAAGGAGGAAGG + Intergenic
1075618995 10:123911976-123911998 CTTTAGAACAGAAAGGAGGGGGG + Intronic
1076150892 10:128161252-128161274 CTGCAGAAGAGTAAAGAGGAAGG - Intergenic
1076772875 10:132676681-132676703 TTGGAGCAGAGTCAGGAGGAGGG - Intronic
1077865723 11:6219664-6219686 TTTTAGAAAAGGAAGAAGGTTGG + Intronic
1079506919 11:21163377-21163399 TTTTAGAATAGTCTGGAGGAAGG + Intronic
1079678024 11:23256771-23256793 TTTCAAAACATTAAGGAGGAGGG - Intergenic
1079757617 11:24284623-24284645 TTTCAAAAAATTAAGGAGGAAGG + Intergenic
1079777209 11:24546807-24546829 TTTTAAAAAATTGAGGAGGAAGG - Intronic
1079782674 11:24627839-24627861 TTGGAGAAGAGTAAGCTGGAGGG - Intronic
1079915636 11:26365516-26365538 TTTTAGAAGATTTATGAGAAAGG - Intronic
1080521063 11:33068217-33068239 TTTTAAAAGAATAAAGAGGCCGG - Intronic
1081061563 11:38484722-38484744 TTTAAGAATAGTAAAAAGGAAGG + Intergenic
1081114795 11:39187203-39187225 TTTGAGAAGGGTAGTGAGGAGGG - Intergenic
1081549933 11:44101550-44101572 TTTTGGCAGAGTATTGAGGAAGG + Intronic
1081837557 11:46168905-46168927 TTTTAAAAGTTTAATGAGGAGGG + Intergenic
1082664310 11:55955528-55955550 TTGAAGAAGAGTAAAGAGGGAGG - Intergenic
1083929311 11:65831532-65831554 TTTGAGAAAAGGATGGAGGATGG - Intronic
1084854163 11:71970415-71970437 CTTTGGAAGACTAAGGTGGAAGG + Intronic
1085232174 11:74981765-74981787 TTCTAGAAGAGAAAGGACAAAGG + Intergenic
1085232356 11:74983110-74983132 TTCTAGAAGAGAAAGGACAAAGG + Intergenic
1086278059 11:85155624-85155646 CTTTAGAAGGCCAAGGAGGATGG + Intronic
1086753327 11:90527333-90527355 TTTTTGATGTGTAAGCAGGAAGG - Intergenic
1087213983 11:95475101-95475123 TTTTGCAAAAGTAAGGAGGTTGG + Intergenic
1087445570 11:98247537-98247559 TTTCAGAACATTAAAGAGGAGGG + Intergenic
1088091233 11:106042204-106042226 TTTGAGAAGAAAAAGGTGGAAGG - Intergenic
1088770759 11:113033678-113033700 TTTTATAAGAGTAAGGAAGCTGG - Intronic
1088778376 11:113109049-113109071 TTTAAGAGGAGTGAGGAGGCCGG + Intronic
1089421609 11:118336063-118336085 TTTTAGGAGGCTGAGGAGGAAGG + Intergenic
1089526454 11:119100469-119100491 TTTTAGAAAAGTGGTGAGGACGG + Intronic
1089787175 11:120916040-120916062 TCCTAGAAGAATGAGGAGGAAGG + Intronic
1090051650 11:123385368-123385390 TTTGAGAGGAGTGAGGAGAATGG - Intergenic
1090555132 11:127866450-127866472 TTATAGAAGAGTAAATAGAATGG + Intergenic
1090602872 11:128390863-128390885 TTTGGCAAGAGAAAGGAGGAAGG - Intergenic
1091338094 11:134788262-134788284 TTTGAGAAGATTAAAGAGGTGGG + Intergenic
1091884280 12:4004528-4004550 TTTGAGGAGAGAAAGGAAGAGGG - Intergenic
1093097037 12:14983619-14983641 TTTTAAAAAAGTAATGGGGAAGG + Intergenic
1093417189 12:18933449-18933471 CTTTAAAAGGGTAAGGCGGAGGG - Intergenic
1095301932 12:40594648-40594670 GAGTAGAAGAGTAGGGAGGAGGG - Intergenic
1095736634 12:45564518-45564540 TTTTAGGAAATTAAAGAGGAAGG - Intergenic
1095809275 12:46354817-46354839 TTTTGGAAGGGTAAGGAGGTGGG + Intergenic
1095960339 12:47830499-47830521 TTTTGGAAGAGGAAAGAGGAAGG - Intronic
1096298797 12:50407495-50407517 TTTTAAAAGAGGAATGAAGATGG + Intronic
1096379518 12:51144275-51144297 TTTTGGAAGGCTAAGGTGGAAGG - Intronic
1096725659 12:53559898-53559920 TTTTAAAAAAGTAAAGAGGAGGG - Intronic
1096764344 12:53871128-53871150 GTTTTAAAGAGTAAGGAGGCTGG + Intergenic
1096918794 12:55061621-55061643 TTTAGGAAGAGAAGGGAGGAGGG - Intergenic
1098050204 12:66445143-66445165 TTTGAAAAGAGTAATGAGCATGG - Intronic
1098250925 12:68568947-68568969 ATCTAGAAGGGTGAGGAGGATGG - Intergenic
1098427657 12:70383754-70383776 TTTTATAAGAGAAAGAAGAAAGG - Intronic
1098472467 12:70861505-70861527 TTATAAAAGCGTAAGAAGGATGG + Intronic
1099450820 12:82804230-82804252 TTTTATGAGATTAAGGAGGTTGG + Intronic
1100143837 12:91653085-91653107 TTTTGTAAGAGCAAGGTGGAAGG - Intergenic
1100183080 12:92106697-92106719 TTTTGGAAGACCAAGGCGGAAGG + Intronic
1100403823 12:94255428-94255450 TTTGAGCAGAGCAGGGAGGAGGG + Intronic
1101122432 12:101597091-101597113 CATTAGAAGAGTAAGGAGTACGG + Intronic
1101244643 12:102874107-102874129 TCTTGGAAGAGACAGGAGGAAGG + Intronic
1101403621 12:104409689-104409711 TGTTAGCAGAAAAAGGAGGAAGG - Intergenic
1101452128 12:104789375-104789397 TTTTAAAAAAGAAAAGAGGAAGG - Intergenic
1101972679 12:109326852-109326874 GTTTAGAAGAGCAAGTGGGATGG + Intergenic
1102851136 12:116246514-116246536 TTTTAGAAAAGTAAGCAGGCTGG + Intronic
1104558182 12:129821026-129821048 TTATATAGGAGAAAGGAGGAGGG - Intronic
1104593902 12:130106457-130106479 TTTTAAAAAAGAAAGGAGCAAGG + Intergenic
1107132598 13:36912253-36912275 TTTTTGTAGGGTAAGGTGGAAGG - Intronic
1107348873 13:39492974-39492996 TTTTAGAAGAATATTGAGGCCGG - Intronic
1107584044 13:41824582-41824604 TTTTAGGAGGGTGAGGAGGGAGG + Intronic
1107847711 13:44534002-44534024 TTTTAGGAGACTGAGGAGGGAGG + Intronic
1108035502 13:46286228-46286250 TGTTACAAGAGAAAGGAGAATGG - Intergenic
1108070619 13:46625218-46625240 TAATAGAAGAGTATGGAAGAGGG - Intronic
1108085960 13:46794140-46794162 TTTTTGGAGGGGAAGGAGGAAGG - Intronic
1108087297 13:46806824-46806846 TTTTAGAAGATGGAGTAGGAGGG + Intergenic
1108812141 13:54240315-54240337 TTAAAGCAGAATAAGGAGGATGG - Intergenic
1109205551 13:59478962-59478984 TTTTAGAAGTCTAATGAGAAAGG + Intergenic
1109267878 13:60221622-60221644 CAATAGAAGGGTAAGGAGGACGG - Intergenic
1109941258 13:69368911-69368933 TTTTAAAAAATCAAGGAGGAAGG + Intergenic
1110652094 13:77953521-77953543 TTTTAGACGAGTAAAGAGATTGG + Intergenic
1110755350 13:79167400-79167422 TTTTAGGATAGGAAGGTGGAGGG + Intergenic
1111029579 13:82577665-82577687 TTTCAAAAAACTAAGGAGGAGGG - Intergenic
1111754568 13:92376771-92376793 TTTTAGGAGATTAAGGCGGGCGG + Intronic
1112705354 13:102061635-102061657 TTTTAGAAGAGCACGTGGGATGG - Intronic
1112828646 13:103421421-103421443 TGTTAGGAAAGTAAGGAGAAGGG - Intergenic
1113392745 13:109913655-109913677 TCTTAGATGAGTCAGAAGGAAGG + Intergenic
1114234139 14:20810111-20810133 CTTTAGAAGAATAAGGAAGTGGG + Intergenic
1114400963 14:22410151-22410173 ATTAAGAAAAGTAAAGAGGAAGG + Intergenic
1114712791 14:24795196-24795218 TATGAGAAAAGTGAGGAGGAAGG + Intergenic
1115507918 14:34110436-34110458 TTCTGGAAGAGAAAGGAGGAGGG - Intronic
1116328341 14:43563056-43563078 TTTTAGATGGGAAAGAAGGAAGG - Intergenic
1116342801 14:43747076-43747098 TTTTAGAAGAGTATATAGGCTGG + Intergenic
1117444026 14:55786826-55786848 TTTGAGGAGAGCAGGGAGGAAGG - Intergenic
1117760257 14:59019484-59019506 TGTTAGAAGAGTTATTAGGAAGG + Intergenic
1118364276 14:65081139-65081161 TTTCAGCAGAGGATGGAGGAAGG - Intronic
1118657204 14:67965441-67965463 TTTGACAAGAGTATGGAGGATGG - Intronic
1118805008 14:69228486-69228508 TTTTAAAAGGCTAAGGAGGCTGG - Intronic
1119977071 14:79037085-79037107 TCTGAGAAGAGGAAAGAGGAAGG + Intronic
1120421395 14:84290661-84290683 GCTTAAAAGAGTAAGGAAGAGGG - Intergenic
1120933212 14:89869244-89869266 TTTTTAAAGTGTGAGGAGGAGGG - Intronic
1121059685 14:90895208-90895230 TTTTAAAAGGGTAATGAGGCTGG + Intronic
1121538632 14:94708455-94708477 TTTAAGGAGAGAAATGAGGATGG + Intergenic
1121880853 14:97499256-97499278 ATTTAGAAGAAGAAGGAAGAAGG + Intergenic
1122539736 14:102491455-102491477 CTTTGGAAGACTAAGGAGGGAGG - Intronic
1123130488 14:105981748-105981770 TATAAGAAGAGGAAGCAGGAGGG - Intergenic
1124087776 15:26567890-26567912 TTATAGAAGAATTAGGAGGGGGG + Intronic
1124701947 15:31922456-31922478 TTTTAGAAAAAAAAGCAGGAGGG - Intergenic
1125986441 15:44057571-44057593 TTTCAGAAGAGTAAGAGTGAAGG - Intronic
1126681961 15:51210952-51210974 TCTCAGAAGTGTAACGAGGATGG + Exonic
1127839785 15:62821174-62821196 TTTTAGATTAGGCAGGAGGAAGG + Intronic
1128526378 15:68415008-68415030 TTTTGCAAGAGTAAAGAGGAGGG - Intronic
1128615710 15:69107389-69107411 TTTTTGACTAGTAAGGAAGAGGG + Intergenic
1129624804 15:77185672-77185694 TTGGAGAAGAGTAGGCAGGAAGG + Intronic
1130214057 15:81952074-81952096 ACTGAGAAGAGTATGGAGGAGGG - Intergenic
1130975180 15:88768444-88768466 TTTAAGAAAAGTATGCAGGATGG - Intergenic
1131244211 15:90775934-90775956 ATTTAGAAGATTAAGGTGGGAGG - Intronic
1131589854 15:93736971-93736993 TTCCAGAAGATTGAGGAGGAGGG - Intergenic
1131926597 15:97391237-97391259 TTGTGGAAGAGAAAGTAGGATGG + Intergenic
1133626563 16:7575443-7575465 TTTAAGAAGAAAAAGGAAGAGGG + Intronic
1134080969 16:11324760-11324782 TTTTGGAAGACCAAGGAGGGAGG - Intronic
1134637389 16:15802852-15802874 ATTTATAAGAGAAAGGAGGCCGG + Intronic
1134811601 16:17171902-17171924 CTTTAGGAGAGGAAGGAGGCTGG + Intronic
1135506169 16:23038367-23038389 TTCTGGAAGAGGAAGAAGGAAGG + Intergenic
1135674568 16:24404466-24404488 TGGTAGAAGAGTCAGCAGGACGG + Intergenic
1136687887 16:32006330-32006352 TTTTGGAAGATAAAAGAGGATGG + Intergenic
1136788488 16:32949885-32949907 TTTTGGAAGATAAAAGAGGATGG + Intergenic
1136881325 16:33904049-33904071 TTTTGGAAGATAAAAGAGGATGG - Intergenic
1137374556 16:47941598-47941620 TTGCAGAAGAGGAAGGAGTAGGG + Intergenic
1137378903 16:47979490-47979512 TTGTAAAAGAGGCAGGAGGAGGG - Intergenic
1137415771 16:48277512-48277534 TACTGGAAGAGTATGGAGGAGGG + Intronic
1137422759 16:48350087-48350109 TTTAAAAATAGTAAGGAGGCTGG + Intronic
1137513984 16:49126507-49126529 TATTAGATGAGTGAGGGGGAAGG - Intergenic
1137622838 16:49887633-49887655 TTTTGGCAGAGTGAGGAGGGAGG + Intergenic
1138491248 16:57378078-57378100 AGCAAGAAGAGTAAGGAGGAGGG - Intronic
1138659109 16:58507438-58507460 TTGTAGAAGAATGAGAAGGAGGG - Intronic
1138747671 16:59382408-59382430 TTTTAAATGAGTACAGAGGAAGG - Intergenic
1140117110 16:72051448-72051470 TTTTAAAATATTAAGGAGGAGGG - Intronic
1140122340 16:72094228-72094250 TTTGACCAGAGCAAGGAGGAAGG - Intronic
1142307100 16:89291927-89291949 TTTTAAAAGAGGCAGGAGGCAGG + Intronic
1203090686 16_KI270728v1_random:1211376-1211398 TTTTGGAAGATAAAAGAGGATGG + Intergenic
1142523476 17:521059-521081 ATTTTGAAGAGTAGGGATGAGGG - Intronic
1143368398 17:6423078-6423100 TTTTAGAAGAGGTCAGAGGAAGG - Intronic
1144071408 17:11674781-11674803 TTTTAGAAGAGAATACAGGAGGG - Intronic
1144096355 17:11903907-11903929 TTTTAAAAAAGAAAGAAGGAAGG + Intronic
1144334341 17:14255524-14255546 TTGTAGGAGAGGGAGGAGGAGGG - Intergenic
1144354988 17:14436722-14436744 TTTTGGAAGAAAAAGGAAGATGG + Intergenic
1144721153 17:17470726-17470748 TTAAAGAAGGGAAAGGAGGAGGG + Intergenic
1146011599 17:29198780-29198802 TTTTAGTAGAGTCAGGAGTTGGG - Intergenic
1146108674 17:30067116-30067138 TTTTAGAAAATTGAAGAGGAGGG + Intronic
1146497777 17:33338196-33338218 TTCTGGAAGGGAAAGGAGGATGG + Intronic
1146606937 17:34268610-34268632 TTTTAGAAGCATCAGGTGGATGG + Intergenic
1146953722 17:36923723-36923745 GTTTAGGAGAGTATGGGGGAGGG - Intergenic
1148019466 17:44543596-44543618 GTTTGGAAGAGTTTGGAGGAGGG + Intergenic
1149097198 17:52857128-52857150 TTTTTTAAGAGTAAAGAAGAGGG + Intergenic
1149270593 17:54973055-54973077 TTTTAGAAAGGGTAGGAGGAAGG + Intronic
1149628008 17:58093680-58093702 GTAGAGAGGAGTAAGGAGGAGGG - Exonic
1149687839 17:58548089-58548111 CAAAAGAAGAGTAAGGAGGAGGG - Intergenic
1150144893 17:62760525-62760547 TTATAGAAGAGTGACAAGGAGGG - Intronic
1150965552 17:69963937-69963959 TTGTTAAAGAGTAAGGAAGATGG - Intergenic
1151057918 17:71055435-71055457 TTAGAGAAGAGAAAGGAAGAAGG - Intergenic
1151269723 17:72984818-72984840 TGTTAAATGAATAAGGAGGAAGG + Intronic
1152260452 17:79263930-79263952 CTTTATAAGAGAAAGGAGGGAGG + Intronic
1153388107 18:4522578-4522600 TTTTAGTAGAGTGATGAGGGTGG + Intergenic
1155438403 18:25836333-25836355 TTGGAGAAGAGTAAGGAGATGGG + Intergenic
1155984264 18:32213330-32213352 CTTTAGAAGAGTAAAATGGAGGG - Exonic
1156482410 18:37444667-37444689 TTTCAGAGGAGGAAGGAGGGAGG + Intronic
1157804048 18:50644911-50644933 TTCTAGAAGAGGATGGAGGTGGG - Intronic
1157932628 18:51840166-51840188 TTTTAGTAGAGCATGGAGGCGGG + Intergenic
1157989122 18:52473917-52473939 TGTCAGAAGAGGAAGGTGGAAGG - Intronic
1158278561 18:55795292-55795314 TTTTAGAGGTGGAAGAAGGAGGG - Intergenic
1158334873 18:56405379-56405401 TCTTAGAGGAGTATGGAGCATGG - Intergenic
1158785164 18:60702975-60702997 TTTTATAACAGAAAGAAGGATGG - Intergenic
1159317014 18:66788525-66788547 TTTTAAAAGGGGAATGAGGAAGG - Intergenic
1159748986 18:72277102-72277124 TTTAAGAAGAGTAGTGAGGGAGG - Intergenic
1159874512 18:73795541-73795563 CTTTAGAATAGTAAAGAGGCTGG + Intergenic
1160170015 18:76545005-76545027 TTTAAGAAGAATAAGTAGAAAGG - Intergenic
1163676092 19:18656026-18656048 TTCTAGATGAGGAAGGAGGCTGG - Intronic
1163930125 19:20381592-20381614 TTTTGGAAGAGTGAGTTGGATGG - Intergenic
1163959434 19:20674342-20674364 TTTTGGAAGAGTGAGGCGGGTGG - Intronic
1164295945 19:23910125-23910147 AACTAGAAGGGTAAGGAGGAGGG - Intergenic
1165052127 19:33148321-33148343 TTTAAGGAAAGGAAGGAGGAAGG - Intronic
1165647099 19:37450183-37450205 TTTCAGAATATTGAGGAGGAGGG - Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
925021838 2:575927-575949 TTTCAGAATATTAAGAAGGAAGG - Intergenic
926328178 2:11803273-11803295 GTTTACTAGAGTTAGGAGGAAGG + Intronic
926778314 2:16444113-16444135 ATTTAAAAGAGCAAGGAGGAAGG - Intergenic
927130760 2:20057383-20057405 TTTTGGGAGGGTTAGGAGGAAGG + Intergenic
927335765 2:21922443-21922465 TTTGATAACAGGAAGGAGGAGGG - Intergenic
927362265 2:22249671-22249693 TATTAGAAAATGAAGGAGGAAGG - Intergenic
928035128 2:27815685-27815707 TCTTAGAAGCTTAAGGAGGGTGG + Intronic
928342645 2:30458501-30458523 TTTTGGATGAGTAGGGAGGTAGG + Intronic
929021217 2:37555192-37555214 GCGAAGAAGAGTAAGGAGGAGGG - Intergenic
929626407 2:43413202-43413224 TTTTAGGATAGAAAGAAGGAAGG - Intronic
929651118 2:43680563-43680585 TTTTAGAAGGGTAAGGAGTCTGG + Intronic
929767918 2:44865454-44865476 GTTTCCAAGAGTTAGGAGGAGGG + Intergenic
929817248 2:45243079-45243101 TTACAGAAGAGTAGAGAGGATGG - Intergenic
930545471 2:52761880-52761902 AATTAGAAGGGTAAGGAGGGAGG + Intergenic
930707719 2:54520981-54521003 TTTAGGAAGAGAAGGGAGGAAGG - Intronic
932537942 2:72619495-72619517 TTTAAAAAGAATGAGGAGGAGGG + Intronic
932911207 2:75807897-75807919 TTGAAGAAGAGAAAGGAGGGTGG + Intergenic
933582834 2:84146844-84146866 TTCTAGAAGACAAAGGAGCATGG + Intergenic
933707114 2:85299621-85299643 TTTTAGGAGACCAAGGTGGATGG + Intronic
936409843 2:112248027-112248049 TTTTATAAAACTAAGGAGGCTGG + Intronic
937027242 2:118709973-118709995 TTTTAGAACAGTAAGAAACAAGG - Intergenic
937519216 2:122691192-122691214 TTGTGGAAGAGTAAGGAGGCCGG + Intergenic
937619428 2:123968553-123968575 TTTTAGTAGAGAAGGGGGGATGG + Intergenic
938193517 2:129304138-129304160 TTTGAGTAGAGAAAGCAGGAGGG - Intergenic
938628381 2:133137451-133137473 TTTTGGAAAAGAAAGGAGAAAGG + Intronic
938782146 2:134594188-134594210 TTATAAAACAGAAAGGAGGATGG + Intronic
938962564 2:136356346-136356368 GGTTAGAAGAGGAGGGAGGATGG + Intergenic
940230129 2:151442315-151442337 ATTTGGAAGAGCAAGGCGGAGGG - Intronic
940501744 2:154502804-154502826 TTTTAAAATAGTAATGATGAGGG - Intergenic
940708224 2:157130236-157130258 TTTTAAAAAATTGAGGAGGAGGG + Intergenic
941219655 2:162760596-162760618 ATTTAGAGGAGTAATGAGAAGGG - Intronic
941293080 2:163700372-163700394 TTGAAGAAGAGAAAGAAGGAAGG + Intronic
941342363 2:164323159-164323181 TTTTAGAAGGCTGAGGAGGAAGG - Intergenic
941654741 2:168131291-168131313 TATTGGGAGAGAAAGGAGGAGGG + Intronic
941962436 2:171267056-171267078 TTTTAGGCAAGTAGGGAGGAGGG - Intergenic
942756311 2:179345428-179345450 TTGTACAAGAAGAAGGAGGAAGG - Intergenic
942801204 2:179878364-179878386 TTTTCCTAGAGTAAAGAGGATGG - Intergenic
943725696 2:191249219-191249241 TTTAAGAAGAGAAATAAGGAGGG + Intronic
944338482 2:198566182-198566204 TTTGAAAAAATTAAGGAGGAGGG - Intronic
944927229 2:204477722-204477744 TTTAGAAAGAGTAGGGAGGAAGG + Intergenic
945047634 2:205795930-205795952 TTTTAGAAGAACATGGAGGAGGG - Exonic
945136263 2:206631094-206631116 TTTTGGAAGACTAAGGTGGGTGG - Intergenic
945695591 2:213099207-213099229 CTTTATAAAAGAAAGGAGGATGG - Intronic
946942669 2:224785951-224785973 TTTTGGAAGACTAAGGTGGGTGG + Intronic
947692825 2:232155225-232155247 CTTTAGAAAATTAAGGAGGGGGG - Intronic
948034852 2:234850100-234850122 TTTTAAAAAAGTAATGAGAAAGG + Intergenic
948392577 2:237623694-237623716 ATTTAGTAGAGAAAGGAGAAAGG + Intergenic
1168751059 20:281733-281755 CTTTGGAAGAGCAAGGTGGAAGG + Intronic
1169010671 20:2247498-2247520 TTTGAGAAAAGGAAGGATGAAGG - Intergenic
1169901836 20:10561382-10561404 TATTAGAAGACTAGGAAGGATGG - Intronic
1170674206 20:18464249-18464271 TTTTAGTAGAGACAGGAGGCTGG + Intronic
1170851840 20:20011870-20011892 TTTTGGAAGACTGAGGTGGATGG + Intergenic
1171520015 20:25768653-25768675 TTTTAGAGGTTTAAGGAGGAAGG - Intronic
1171556904 20:26087840-26087862 TTTTAGAGGTTTAAGGAGGAAGG + Intergenic
1171559266 20:26107975-26107997 TTTTGGAATAGTAAGTTGGATGG - Intergenic
1173359689 20:42331321-42331343 TTTTAAAAGAGTAATCAGTAGGG + Intronic
1173468724 20:43305676-43305698 TTGGAGAAGAGTAAGGAAGAGGG + Intergenic
1174660802 20:52211251-52211273 TTTTAGATTACTAAGGAGCAAGG - Intergenic
1175022841 20:55869315-55869337 TTTCAAAAAAGTAAGGAAGAGGG + Intergenic
1175599297 20:60259848-60259870 TTTTAGAAAAGTAAAGAAAATGG - Intergenic
1176522810 21:7837708-7837730 TTTTAGAAAAATAAGGTTGAGGG + Intergenic
1176654148 21:9574940-9574962 TTTTAGAGGTTTAAGGAGGAAGG - Intergenic
1176983390 21:15408601-15408623 TTGTTGGAGAGTAAGGAAGATGG + Intergenic
1177372389 21:20220816-20220838 TTTTTGAAGAGTGAGGTAGATGG - Intergenic
1177616183 21:23524029-23524051 TTTTAAAAGACTAAGCAGGTTGG + Intergenic
1177834872 21:26177030-26177052 TTTTAGGAGATCAAGGAGGGTGG - Intergenic
1177903498 21:26946808-26946830 TTTTAGAGGAGGCAGGGGGATGG + Intronic
1178046534 21:28700749-28700771 TTTCAGAAAATTGAGGAGGAGGG + Intergenic
1178574934 21:33778319-33778341 TTTTAGAAAATAGAGGAGGAAGG - Intronic
1178656830 21:34467720-34467742 TTTTAGAAAAATAAGGTTGAGGG + Intergenic
1178724796 21:35041976-35041998 GTTTAAAAGAGTGAGGAAGATGG + Intronic
1181378016 22:22475954-22475976 TTTTAGGAGGCTGAGGAGGAAGG - Intergenic
1181934180 22:26427860-26427882 TTCTAGAAGAGAGAGGAGGTGGG + Intergenic
1182011213 22:27002211-27002233 ACTTAGAAGAGAAAGGAAGAAGG + Intergenic
1182137002 22:27915492-27915514 TTTGAGGAGAGTAGGGAGAAAGG - Intronic
1184038460 22:41929447-41929469 ATTTACAGGAGTTAGGAGGAGGG + Intergenic
949241270 3:1875217-1875239 TTTTAGGAAAGTATAGAGGAAGG + Intergenic
949381704 3:3454113-3454135 TTTTAGAAGAGAACTGAGGAAGG + Intergenic
949787979 3:7762473-7762495 GTTTAGAAAAGAAAGGAGCAAGG + Intergenic
950454121 3:13082642-13082664 GTTTAGAACAGTAAGAAGGGAGG - Intergenic
951020057 3:17773594-17773616 TTTTAGCAGAATAATGATGATGG - Intronic
951198231 3:19847722-19847744 TTTGGGAAGAGTAGGGAGAAGGG + Intergenic
951870096 3:27352072-27352094 ATTGGGAAGAGTAAGGGGGAAGG + Intronic
951903983 3:27685513-27685535 TTTTGGAAGAGCATGTAGGATGG - Intergenic
953578402 3:44131362-44131384 TTGTAGAAGTGTAAAGGGGAAGG - Intergenic
954053408 3:48001795-48001817 TTTAAGAAAAGTAAGCAGGCTGG - Intronic
954480224 3:50792943-50792965 TTCTAAAAAACTAAGGAGGAGGG - Intronic
955087232 3:55715073-55715095 TTTTAAAAGATTAAGGTGGAAGG - Intronic
955223660 3:57043727-57043749 GATTACAAGAGTGAGGAGGAGGG + Intronic
956032361 3:65052410-65052432 TTTAATAAGAGTAAGGTGCAGGG - Intergenic
957364739 3:79208304-79208326 TTTTACAAGAATAAAAAGGATGG - Intronic
957911854 3:86629198-86629220 TTTAAGAAGAAAAAGAAGGAAGG - Intergenic
957977393 3:87464618-87464640 TTCCAAAAGATTAAGGAGGAGGG + Intergenic
959250662 3:103939442-103939464 TTTTGGAAGGGTAGGGAGGAGGG - Intergenic
959611331 3:108298194-108298216 TGACAGAAGAATAAGGAGGAAGG - Intronic
959839299 3:110955868-110955890 TTTCAGAAGATTAAGAAGGATGG - Intergenic
960024837 3:112996811-112996833 TCTTAGTACAGTAAGGAAGAGGG + Intronic
962658078 3:137569802-137569824 TGGTAGAAGAGAGAGGAGGAAGG - Intergenic
963420819 3:145058994-145059016 TTTTAAAAGACTGAGGAAGAGGG + Intergenic
963981077 3:151537782-151537804 TTTTAGAAGGGAAAGAAGGTAGG - Intergenic
964351890 3:155811181-155811203 TCTTAGAAGAGAAGGAAGGATGG - Intergenic
964779177 3:160316150-160316172 CTTTAGCAGAGCAAGCAGGAAGG - Intronic
965940752 3:174178131-174178153 ATTTAGAAGAATAAGTGGGAAGG + Intronic
965962521 3:174445151-174445173 TTTTAGTAGAGTGAGGAGAAGGG + Intronic
965993666 3:174851689-174851711 TTTCAGAAAATTTAGGAGGAGGG + Intronic
966185220 3:177221062-177221084 GTCTAGAAGAGGAAGGGGGAAGG - Intergenic
966274854 3:178153128-178153150 GTTTAGAAGGGTGAGGGGGAGGG - Intergenic
967276971 3:187785412-187785434 CTTTAGAAGACCAAGGAGGGAGG - Intergenic
967354728 3:188555694-188555716 GTTTAGAAGAGAAAGGAGAAAGG + Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
969434312 4:7176942-7176964 TTTTAGAAAATAGAGGAGGAGGG - Intergenic
970090841 4:12406128-12406150 TGTAAGATGAGTAATGAGGAGGG + Intergenic
970512231 4:16792801-16792823 TTTAACAAGAGGAAGGAGGAAGG + Intronic
970664889 4:18325657-18325679 TATTAAAAGATTAAGAAGGATGG - Intergenic
970781085 4:19738828-19738850 TTTTAGCAGAGTTAGGTGGGAGG + Intergenic
971040561 4:22747386-22747408 CTTTAGAAGACCAAGGAGGTTGG + Intergenic
971446712 4:26758139-26758161 TTTTATAAGAACAAGGAGAAGGG - Intergenic
971655250 4:29336006-29336028 TTATAGAAGAAAAAGGAGGAAGG - Intergenic
972115497 4:35628342-35628364 TTTTGGATGGGAAAGGAGGAAGG - Intergenic
972636239 4:40886533-40886555 CTGTAAAAGAATAAGGAGGAAGG + Intronic
972789349 4:42355994-42356016 TGTGAGAAGAGTGGGGAGGAGGG + Intergenic
974660481 4:64881800-64881822 TGATAGAAGGGTAAGGAGAAAGG - Intergenic
975082360 4:70296415-70296437 AATTAGAAGGGTAAGAAGGATGG - Intergenic
975613789 4:76226409-76226431 TTTTGGGAGAGCAAGGAGCAAGG + Intronic
975799044 4:78039572-78039594 CTTTAGAAGAGAGAGGAAGAAGG + Intergenic
976177060 4:82365390-82365412 TTTTAGAAGAATAATTATGATGG - Intronic
976766541 4:88603827-88603849 TTCTACAACAGAAAGGAGGAGGG - Intronic
976867738 4:89750965-89750987 TTTTTGAAAAGTAAAGAAGATGG - Intronic
977444267 4:97109565-97109587 TTGTAGAAGAATATGGAAGAAGG + Intergenic
977578623 4:98700946-98700968 TTTTAGAAGAGTAAATTGGCAGG - Intergenic
978220834 4:106272352-106272374 TCTTGGAAGAGAAAGGATGATGG - Intronic
979999280 4:127469823-127469845 TTTGAGAAAAGAAAGGAGGAAGG + Intergenic
981399703 4:144299628-144299650 TTTTAGAAAAGTGAGAAGCATGG - Intergenic
981956046 4:150475651-150475673 CTTTAGAAGGCTAAGGAGGGAGG + Intronic
982566291 4:156991249-156991271 TTTTAGAGGAGGAAGGATTACGG + Intergenic
983172393 4:164551031-164551053 TTATGCAAGAGTCAGGAGGATGG + Intergenic
983593782 4:169442788-169442810 TTTTAGAAAAGGAAGGCAGAAGG + Intronic
984216737 4:176922578-176922600 TTATTGAAGGGTAGGGAGGACGG - Intergenic
984256041 4:177391279-177391301 TTTCAGAAGAATATGGTGGACGG - Intergenic
984277340 4:177626736-177626758 TTTTAAAGCAGCAAGGAGGACGG - Intergenic
984552701 4:181180046-181180068 TTTTTGAGGAGTAACGAGGAGGG - Intergenic
986078284 5:4361052-4361074 TTTTAGAAGTTTAAACAGGAAGG + Intergenic
986678401 5:10210878-10210900 TTTAAAAAGAGAAAGGAAGAAGG + Intergenic
988782533 5:34535893-34535915 ATTTGGAAGACTATGGAGGAAGG - Intergenic
990088171 5:52004769-52004791 GATTAGAAAAGTAAGGTGGAAGG - Intergenic
990618934 5:57539047-57539069 TGAAAGAAGAGAAAGGAGGAAGG + Intergenic
990709639 5:58565760-58565782 TTATAAAAGGGTAAGGAGGCTGG + Intergenic
991341485 5:65615511-65615533 TTTTTTAAGAGCCAGGAGGAAGG - Intronic
993513540 5:88801188-88801210 TTTTAGAGGGTTAAGGAAGAGGG + Intronic
993535684 5:89083094-89083116 ACTTAGAAGAGAAAGCAGGAAGG - Intergenic
994249684 5:97521309-97521331 TGTTTGGAGAGTAAGGAAGAGGG - Intergenic
994437013 5:99749230-99749252 TTTTAGGAGACTAAGGCAGATGG + Intergenic
994584949 5:101695274-101695296 TTTCAGGAGACTAAGGTGGATGG - Intergenic
994950218 5:106452305-106452327 TTCTAAAAGAGGAAGGATGAGGG + Intergenic
995788348 5:115855852-115855874 TTTTAAAAGAATGATGAGGATGG + Intronic
996223840 5:120965387-120965409 AATTAGAAGGGTAAGGGGGAAGG + Intergenic
996261623 5:121477820-121477842 TTATACAAGAGGAAGAAGGAAGG - Intergenic
996362507 5:122665665-122665687 TTTCTGAAGAGAAGGGAGGAGGG + Intergenic
996480582 5:123971110-123971132 TTTTAGAAGGGCATGTAGGATGG + Intergenic
996838070 5:127816086-127816108 TTAGAGAAAAGTAATGAGGAGGG + Intergenic
996931687 5:128896557-128896579 TTTTAGAAGAGGAGAGAGAAGGG - Intronic
997084266 5:130778491-130778513 TTTAAAAAGAAAAAGGAGGAAGG + Intergenic
997173176 5:131745914-131745936 TTTTCTAGGAGTAAGGTGGAGGG + Intronic
997420943 5:133766229-133766251 TTTTAAAACAGAAAAGAGGAAGG + Intergenic
998008467 5:138673787-138673809 TTCTAGAAGAGCATGTAGGATGG - Intronic
998326467 5:141284903-141284925 TTTTAGAAGATGGAGGAGCAGGG - Intergenic
998458269 5:142290530-142290552 TTTTGGAAGAGTGAGGATGGAGG + Intergenic
998527088 5:142852450-142852472 TTTTGTAAGAGTTAGAAGGATGG - Intronic
999966556 5:156816461-156816483 TTTTATAAGAGGAAGGCGGTTGG + Intergenic
1000332765 5:160219101-160219123 TTTTAGTGGAGGAAAGAGGAAGG + Intronic
1000445359 5:161312428-161312450 ATTTAGAAAGGTAAGAAGGAAGG + Intronic
1001154453 5:169261152-169261174 TTACAGAAGAGTATGGAGGAAGG + Intronic
1001222797 5:169916955-169916977 ATTTGGAAGAGTAATGACGATGG - Intronic
1001325952 5:170724231-170724253 TTTTAGAAAATAGAGGAGGATGG + Intronic
1002540254 5:179902168-179902190 GTCCAGAGGAGTAAGGAGGAAGG + Intronic
1003018340 6:2487244-2487266 TTTTAGAAGTGTAAGGACATAGG + Intergenic
1003720520 6:8696868-8696890 TTTTGATAGAGTAAGAAGGATGG + Intergenic
1003725958 6:8764313-8764335 TTTTAGAAGGACCAGGAGGAAGG - Intergenic
1003831394 6:10016024-10016046 TTTTAGGACAGCAGGGAGGATGG - Intronic
1005229258 6:23681342-23681364 TTATAGAAGAGGAAGGGGGATGG - Intergenic
1005265864 6:24111690-24111712 TTTAAGAAGAGCAAGGAGTCTGG + Intergenic
1006020652 6:31115830-31115852 TTTGAGAAGAGGAAGGAGGAAGG + Exonic
1006050168 6:31336070-31336092 TTTTAGATGACAAAGGAGGATGG + Intronic
1006057821 6:31398710-31398732 TTTTAAAAGGTTAAGGAGGCTGG - Intergenic
1006070254 6:31493240-31493262 TTTTAAAAGGTTAAGGAGGCTGG - Intergenic
1006105853 6:31715823-31715845 TTTTAGGAGAATAAGGAGGTGGG - Intronic
1006514027 6:34536162-34536184 GTTTGGAGGAGTAAGGAAGATGG - Intergenic
1006699823 6:35962988-35963010 TTTTGGCAAATTAAGGAGGAGGG - Intronic
1006756640 6:36421832-36421854 TAAAAGAAGAGTAAGGAGGTTGG - Intronic
1007122812 6:39397429-39397451 TTTTCAAAGAGGAAAGAGGAAGG + Intronic
1007465141 6:42046394-42046416 TGGTAGATGAGTAAGGAAGATGG - Intronic
1008080081 6:47185122-47185144 TTTTAGAAATGTAGAGAGGAAGG + Intergenic
1008332122 6:50258025-50258047 TTTCAAAAAATTAAGGAGGAGGG - Intergenic
1008660877 6:53666176-53666198 TTCTAGTAGAGTAAGGAGAAGGG + Intergenic
1008704182 6:54137750-54137772 TCTTTGAAGAGTAAACAGGATGG + Exonic
1008713748 6:54262786-54262808 TTTAAGAAAAAGAAGGAGGAGGG + Intronic
1009531188 6:64818149-64818171 TTTGATAAGACTTAGGAGGATGG - Intronic
1010012629 6:71067248-71067270 AATTAGAAGAGTATGGAGGTGGG + Intergenic
1010950257 6:82028274-82028296 TTTTAGAAGGTTGAGTAGGATGG - Intergenic
1011667228 6:89646264-89646286 ATTTATAAGAGAAAGGAGCAAGG - Intronic
1011865899 6:91826561-91826583 GTTGAGTAGAGGAAGGAGGAAGG - Intergenic
1013655027 6:112237709-112237731 TGTTTGAAGAGTAAGGATGAAGG - Intronic
1013686382 6:112589494-112589516 TTTTAGAAAAGTAAGATGGCGGG + Intergenic
1013913323 6:115304531-115304553 TTTGAGAAAATTAAAGAGGAGGG - Intergenic
1015698896 6:136012708-136012730 TTTTAGCTGAGAAATGAGGAAGG + Intronic
1015750774 6:136556255-136556277 CTTTAGGAGGCTAAGGAGGACGG + Intergenic
1015958223 6:138620423-138620445 TTTGAGAAGGGTAAGGGGTAAGG + Intronic
1017108320 6:150909012-150909034 TTTTACGGGGGTAAGGAGGAGGG - Intronic
1017297646 6:152817474-152817496 TTTGAGAAGACTGAGGGGGAAGG + Intergenic
1017981728 6:159406695-159406717 TTAGACAAGAGTAAGGAGGAGGG + Intergenic
1018288581 6:162266810-162266832 TTTCAGAAAACTAAAGAGGATGG + Intronic
1020574482 7:9908796-9908818 TTTTAAAAAATAAAGGAGGATGG - Intergenic
1021515255 7:21477492-21477514 TTTTAAAAGTGTAAGGAACAAGG - Intronic
1021799553 7:24290555-24290577 TTTTAGAAGAGAACTGAGGGAGG - Intronic
1021838633 7:24704929-24704951 TTTTGGGAGGGTAAGGTGGAAGG - Intronic
1022374047 7:29796945-29796967 GTGGAGAAGAGTTAGGAGGAGGG + Intergenic
1022518330 7:30989469-30989491 TCTGTGAAGAGTCAGGAGGAGGG + Intronic
1022628233 7:32060315-32060337 TTTGATAAGAGTTGGGAGGAAGG - Intronic
1022628855 7:32066261-32066283 TGTTAGCATAGTAAGGTGGATGG + Intronic
1023628594 7:42140803-42140825 TTATACAAGAAAAAGGAGGAGGG + Intronic
1023740365 7:43275555-43275577 TTTTAGAAAAGTAGGGGTGAGGG + Intronic
1024097374 7:45993604-45993626 TTTCAGAAGAATACAGAGGAGGG - Intergenic
1024115649 7:46190566-46190588 CTTTAGAAGGCTAAGGAGGGTGG - Intergenic
1024959745 7:54961591-54961613 TTTTAAAAGTGTAAGCAGGCTGG + Intergenic
1025280500 7:57623614-57623636 TTTTAGAGGTTTAAGGAGGAAGG - Intergenic
1025304231 7:57841893-57841915 TTTTAGAGGTTTAAGGAGGAAGG + Intergenic
1025909828 7:65819411-65819433 CTTTATAAGAGAAAGGAGGTAGG + Intergenic
1026620359 7:71944857-71944879 TTGAAGAAGAGTTAGGAGGCAGG + Intronic
1027537542 7:79423898-79423920 TCTAGGAAGAGTTAGGAGGAAGG + Intronic
1027737652 7:81954418-81954440 TTTTTAAAGAGTAATGAGAAAGG - Intronic
1028170576 7:87590866-87590888 TTTTAGAAGAGCAAAAAGGAAGG + Intronic
1028478615 7:91279444-91279466 TTTTAGAAGAATATAAAGGATGG - Intergenic
1028894193 7:96022564-96022586 TTTTAGAAGAAAAAAGAGGCTGG + Intronic
1029298721 7:99561771-99561793 TTTTACTAGAGTATTGAGGAGGG + Intronic
1029499418 7:100918870-100918892 TTTTAGAACAGGAACGAGGCCGG - Intergenic
1030194135 7:106836477-106836499 CTTCAGAAGAGTAAAGATGAGGG - Intergenic
1030651969 7:112126042-112126064 TTTTGGGAGACCAAGGAGGATGG - Intronic
1030934604 7:115569824-115569846 TTTAGGAAGAGAAAGGAAGAAGG - Intergenic
1031039465 7:116823862-116823884 TTTCAGAAAATTGAGGAGGAGGG - Intronic
1033325481 7:140374524-140374546 TTTTAGAATATTAAAGAGGCCGG + Intronic
1033907277 7:146220904-146220926 TATTTGAAGGGTCAGGAGGAAGG - Intronic
1036591056 8:10168501-10168523 TTTTTGGAAAGTAGGGAGGAGGG + Intronic
1036660626 8:10706148-10706170 TCTTAGAATATTAAGCAGGAAGG - Intronic
1036731136 8:11265929-11265951 TTTTTGAAGAAAAATGAGGAGGG - Intergenic
1037449612 8:19003622-19003644 TTTTAAAAGAGGAGGGAAGAAGG + Intronic
1037555403 8:20017559-20017581 TTTTAGGGGAGTCATGAGGACGG - Intergenic
1038213725 8:25542749-25542771 TTTTAAGAGACTAAGGAGGCCGG + Intergenic
1039563461 8:38531515-38531537 CTTGGGAAGAGGAAGGAGGAAGG + Intergenic
1040839249 8:51767280-51767302 TTTTCACAGAGAAAGGAGGAGGG - Intronic
1040980430 8:53241405-53241427 TTCTAGAAAAGAAAGGAGGGAGG + Intronic
1042229773 8:66544005-66544027 TTTTATCAGAGTAAGAGGGAAGG + Intergenic
1042346659 8:67734292-67734314 TTTTAGAATAGTAGTGTGGAAGG + Intronic
1044055009 8:87557931-87557953 TTTTAGAATATTAAGGACCATGG - Intronic
1045107465 8:98906902-98906924 TTTTGGGAGACTAAGGAGGGAGG + Intronic
1046509800 8:115187466-115187488 TTTCAGGAGAGTAGGGAGGCTGG + Intergenic
1046860573 8:119086693-119086715 TTATAGAAGGGGAAGAAGGAAGG + Intronic
1047102640 8:121694922-121694944 TTATAGAAAAGTATGGAGGCTGG - Intergenic
1047924905 8:129673358-129673380 TTTTAAAAGTGTGAAGAGGAAGG - Intergenic
1048092830 8:131259798-131259820 TTTTAGAAATGTAAGGCAGAGGG - Intergenic
1048267135 8:132997665-132997687 ATTTAGTGGAGTAAAGAGGAAGG + Intronic
1048680475 8:136835948-136835970 TTCAAGCAGAGGAAGGAGGAGGG - Intergenic
1049937130 9:510053-510075 TTTTAGGAGGGCAAGGAGGGAGG - Intronic
1050303248 9:4280740-4280762 TCTGAGAAGAGTGAGGAGGAAGG - Intronic
1050686702 9:8178630-8178652 TTTTAGAAGAGGTAGGAGAGCGG - Intergenic
1050721197 9:8592203-8592225 TTTAAGAAGAGCTAGAAGGAGGG - Intronic
1050723080 9:8613299-8613321 TTCTAGAAGAGAGAGCAGGAAGG + Intronic
1051095274 9:13459027-13459049 TCTTAGAAGAGTATAGAGGTAGG - Intergenic
1051204990 9:14678079-14678101 ATTTAGATGAGTAAGCAGAATGG - Intronic
1051700810 9:19821669-19821691 TATTAGAAAATTAATGAGGATGG - Intergenic
1051754713 9:20386314-20386336 ATGTTGAAGAGTAAGGAGAAGGG + Intronic
1051893455 9:21965851-21965873 TTGAGGAAGGGTAAGGAGGAAGG + Intronic
1052409441 9:28104211-28104233 TATGAGAAGAGTAAGGAGTAGGG + Intronic
1053377212 9:37617807-37617829 TTTTAGGAAAGTAGGAAGGAAGG - Intronic
1055634462 9:78261546-78261568 CTTTAAAGGAGTAATGAGGAGGG + Intronic
1055725751 9:79226394-79226416 TTTTAAAAGGAGAAGGAGGAAGG - Intergenic
1056246892 9:84704854-84704876 TTTGAGAACAGTAGGGAGGAAGG + Intronic
1056849513 9:90070482-90070504 TTGAAGAAGAGCATGGAGGATGG + Intergenic
1057419275 9:94897131-94897153 ATTTTGAAGAGTAATGATGAGGG + Intronic
1058394816 9:104539252-104539274 TTTAAGAAGAGAGAGAAGGAGGG + Intergenic
1058904769 9:109473868-109473890 TTTTAAAAAACTCAGGAGGATGG - Intronic
1059073532 9:111165646-111165668 TTTCAGAAGGGTAGGCAGGATGG + Intergenic
1059929361 9:119245664-119245686 TTTAGGAAGAGGAAAGAGGAAGG - Intronic
1060553818 9:124498369-124498391 TTTGAGAAGGGGAAGCAGGAAGG + Intronic
1061905732 9:133695965-133695987 TTCTGGAAGAGTAGAGAGGAAGG + Intronic
1062129329 9:134884060-134884082 TTCAAGCAGAGTCAGGAGGAGGG - Intronic
1203631871 Un_KI270750v1:78398-78420 TTTTAGAGGTTTAAGGAGGAAGG - Intergenic
1185810745 X:3107657-3107679 GTTTAAAAGAGTAATCAGGATGG + Intronic
1186024536 X:5294896-5294918 CTTTGGGAGAGAAAGGAGGAAGG + Intergenic
1186119466 X:6343759-6343781 TTTTATAAGAGATAGGATGATGG + Intergenic
1187054178 X:15726031-15726053 TTTTAAAAGAGAAAAGAGGGTGG - Intronic
1187460881 X:19485716-19485738 TTCTAGAAGAGCTAGCAGGAAGG + Intronic
1187737029 X:22315170-22315192 TTTTAGAAGAGAAAGAGAGAAGG - Intergenic
1188234775 X:27714749-27714771 TTTTGGAAGAGTAGGGAAAATGG - Intronic
1188408971 X:29847941-29847963 TTTTAAAAGAATAAGCAGAATGG - Intronic
1188579497 X:31692881-31692903 TTTTGGAAAACTAAAGAGGAAGG + Intronic
1188919132 X:35950065-35950087 TCTTAGAAGAGTGAGAAGGTGGG + Intronic
1189737772 X:44089068-44089090 TTTTGGATGAAGAAGGAGGAGGG + Intergenic
1189951999 X:46241874-46241896 TTTTAAAAGATTGAAGAGGAGGG + Intergenic
1190342739 X:49310499-49310521 TGTCAAAAGAGTAAGGAGAATGG + Intronic
1190738412 X:53270949-53270971 TTTTAGAAGGGAAATGAGGGAGG - Intronic
1191611977 X:63126132-63126154 TTCTTAAAAAGTAAGGAGGAAGG + Intergenic
1191645105 X:63471600-63471622 TCTGAGAAGTGTAAAGAGGAAGG + Intergenic
1191725791 X:64279176-64279198 TTTGAGAAGTGTTAGGGGGAAGG - Intronic
1192001241 X:67154075-67154097 TTTTAAAGGAGTATGTAGGAAGG - Intergenic
1192452171 X:71251436-71251458 TGTAAGGAGAGTTAGGAGGAGGG - Intronic
1192487491 X:71541942-71541964 TTTTAATAGACAAAGGAGGAGGG - Intronic
1192691405 X:73368727-73368749 TTTCAAAACATTAAGGAGGAGGG - Intergenic
1193420143 X:81272798-81272820 TTTTAGAAAAGTAATGAGCCTGG - Intronic
1193679996 X:84506861-84506883 TTTTAGAAGGGCAAGGTGTAAGG - Intergenic
1194553024 X:95324470-95324492 TTTTTAAAAAGCAAGGAGGAGGG + Intergenic
1194774957 X:97951823-97951845 TTTAAGAAAATAAAGGAGGAAGG + Intergenic
1195034391 X:100958582-100958604 TTTGAGAAAAGAGAGGAGGAGGG + Intergenic
1196143537 X:112291935-112291957 TCTTAGGAGAGAAGGGAGGAGGG - Intergenic
1196898328 X:120359652-120359674 TTTTTGAAGTGCATGGAGGAGGG - Intergenic
1196968690 X:121085546-121085568 TATGAGAATAGTAAGGGGGAAGG - Intergenic
1197009131 X:121539493-121539515 GTTTAGGAGAGTAAGGTGCAGGG + Intergenic
1197604178 X:128564994-128565016 TTTTTCCAGAATAAGGAGGAGGG + Intergenic
1198175881 X:134153911-134153933 TTTTGGGAGACCAAGGAGGAAGG + Intergenic
1198224966 X:134636712-134636734 TTTAATTAGAGTAAGGATGAAGG - Intronic
1198473624 X:136974189-136974211 TTTTAGAAGAATAAAGAGTAAGG - Intergenic
1199049868 X:143224474-143224496 ATTTCAAAGAGAAAGGAGGAGGG + Intergenic
1201673064 Y:16546993-16547015 TGTTAGAAGAGTAGTGAGCAAGG + Intergenic
1201723697 Y:17132064-17132086 CTTTAGGAGAGTAAAGATGAGGG + Intergenic
1202199655 Y:22332462-22332484 TTTGATACAAGTAAGGAGGAAGG + Intronic
1202203089 Y:22375222-22375244 TTTTTAAAGAGCAAGTAGGAAGG - Intronic
1202232326 Y:22670011-22670033 TTTGATACAAGTAAGGAGGAAGG + Intergenic
1202310830 Y:23526147-23526169 TTTGATACAAGTAAGGAGGAAGG - Intergenic
1202559972 Y:26144447-26144469 TTTGATACAAGTAAGGAGGAAGG + Intergenic
1202580148 Y:26371871-26371893 TTTTAGGAAGGTAAGGAGGGAGG + Intergenic