ID: 909734095

View in Genome Browser
Species Human (GRCh38)
Location 1:78934439-78934461
Sequence ATTTTCTTCTAGGAGTTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 24006
Summary {0: 9, 1: 140, 2: 1479, 3: 15880, 4: 6498}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909734095_909734099 3 Left 909734095 1:78934439-78934461 CCATAAAACTCCTAGAAGAAAAT 0: 9
1: 140
2: 1479
3: 15880
4: 6498
Right 909734099 1:78934465-78934487 GGTAATACCATTTAGGACATAGG 0: 15
1: 430
2: 9508
3: 11944
4: 4724
909734095_909734098 -4 Left 909734095 1:78934439-78934461 CCATAAAACTCCTAGAAGAAAAT 0: 9
1: 140
2: 1479
3: 15880
4: 6498
Right 909734098 1:78934458-78934480 AAATGTAGGTAATACCATTTAGG 0: 1
1: 3
2: 147
3: 1474
4: 11518
909734095_909734100 8 Left 909734095 1:78934439-78934461 CCATAAAACTCCTAGAAGAAAAT 0: 9
1: 140
2: 1479
3: 15880
4: 6498
Right 909734100 1:78934470-78934492 TACCATTTAGGACATAGGCATGG 0: 236
1: 13886
2: 7343
3: 2460
4: 1180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909734095 Original CRISPR ATTTTCTTCTAGGAGTTTTA TGG (reversed) Intronic
Too many off-targets to display for this crispr