ID: 909734098

View in Genome Browser
Species Human (GRCh38)
Location 1:78934458-78934480
Sequence AAATGTAGGTAATACCATTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 13143
Summary {0: 1, 1: 3, 2: 147, 3: 1474, 4: 11518}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909734093_909734098 3 Left 909734093 1:78934432-78934454 CCCAAAACCATAAAACTCCTAGA 0: 7
1: 656
2: 14279
3: 7940
4: 7301
Right 909734098 1:78934458-78934480 AAATGTAGGTAATACCATTTAGG 0: 1
1: 3
2: 147
3: 1474
4: 11518
909734095_909734098 -4 Left 909734095 1:78934439-78934461 CCATAAAACTCCTAGAAGAAAAT 0: 9
1: 140
2: 1479
3: 15880
4: 6498
Right 909734098 1:78934458-78934480 AAATGTAGGTAATACCATTTAGG 0: 1
1: 3
2: 147
3: 1474
4: 11518
909734094_909734098 2 Left 909734094 1:78934433-78934455 CCAAAACCATAAAACTCCTAGAA 0: 2
1: 99
2: 1040
3: 1755
4: 2458
Right 909734098 1:78934458-78934480 AAATGTAGGTAATACCATTTAGG 0: 1
1: 3
2: 147
3: 1474
4: 11518

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909734098 Original CRISPR AAATGTAGGTAATACCATTT AGG Intronic
Too many off-targets to display for this crispr