ID: 909734100

View in Genome Browser
Species Human (GRCh38)
Location 1:78934470-78934492
Sequence TACCATTTAGGACATAGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 25105
Summary {0: 236, 1: 13886, 2: 7343, 3: 2460, 4: 1180}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909734093_909734100 15 Left 909734093 1:78934432-78934454 CCCAAAACCATAAAACTCCTAGA 0: 7
1: 656
2: 14279
3: 7940
4: 7301
Right 909734100 1:78934470-78934492 TACCATTTAGGACATAGGCATGG 0: 236
1: 13886
2: 7343
3: 2460
4: 1180
909734097_909734100 -2 Left 909734097 1:78934449-78934471 CCTAGAAGAAAATGTAGGTAATA 0: 3
1: 64
2: 1174
3: 10464
4: 11989
Right 909734100 1:78934470-78934492 TACCATTTAGGACATAGGCATGG 0: 236
1: 13886
2: 7343
3: 2460
4: 1180
909734095_909734100 8 Left 909734095 1:78934439-78934461 CCATAAAACTCCTAGAAGAAAAT 0: 9
1: 140
2: 1479
3: 15880
4: 6498
Right 909734100 1:78934470-78934492 TACCATTTAGGACATAGGCATGG 0: 236
1: 13886
2: 7343
3: 2460
4: 1180
909734094_909734100 14 Left 909734094 1:78934433-78934455 CCAAAACCATAAAACTCCTAGAA 0: 2
1: 99
2: 1040
3: 1755
4: 2458
Right 909734100 1:78934470-78934492 TACCATTTAGGACATAGGCATGG 0: 236
1: 13886
2: 7343
3: 2460
4: 1180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909734100 Original CRISPR TACCATTTAGGACATAGGCA TGG Intronic
Too many off-targets to display for this crispr