ID: 909734196

View in Genome Browser
Species Human (GRCh38)
Location 1:78935462-78935484
Sequence ACACAGTTATACGTGAGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5794
Summary {0: 1, 1: 0, 2: 40, 3: 805, 4: 4948}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909734196 Original CRISPR ACACAGTTATACGTGAGCCA TGG (reversed) Intronic
Too many off-targets to display for this crispr