ID: 909735262

View in Genome Browser
Species Human (GRCh38)
Location 1:78951161-78951183
Sequence CTGTAAGCTGAGATGGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 212}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909735262_909735267 -9 Left 909735262 1:78951161-78951183 CCAGGTTCCATCTCAGCTTACAG 0: 1
1: 0
2: 1
3: 19
4: 212
Right 909735267 1:78951175-78951197 AGCTTACAGAGCATGGGTATGGG No data
909735262_909735268 -8 Left 909735262 1:78951161-78951183 CCAGGTTCCATCTCAGCTTACAG 0: 1
1: 0
2: 1
3: 19
4: 212
Right 909735268 1:78951176-78951198 GCTTACAGAGCATGGGTATGGGG No data
909735262_909735266 -10 Left 909735262 1:78951161-78951183 CCAGGTTCCATCTCAGCTTACAG 0: 1
1: 0
2: 1
3: 19
4: 212
Right 909735266 1:78951174-78951196 CAGCTTACAGAGCATGGGTATGG 0: 1
1: 0
2: 1
3: 12
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909735262 Original CRISPR CTGTAAGCTGAGATGGAACC TGG (reversed) Intronic
900281521 1:1872650-1872672 CTGAAGGATGAGAAGGAACCAGG - Intronic
901037664 1:6346056-6346078 CTGGAAGCAGAGAGGGAGCCAGG + Intronic
903327137 1:22575814-22575836 CTGGCAGCTGATATGGAAACTGG + Intronic
903948812 1:26981719-26981741 CTGAAAGATGAGCAGGAACCAGG - Intergenic
904598228 1:31659855-31659877 CTGTAATGTGAGGGGGAACCAGG + Intronic
906539208 1:46572149-46572171 ATGTGGGCTAAGATGGAACCTGG + Exonic
906799338 1:48722238-48722260 CAGTAAGATGAAATGGAACAGGG + Intronic
907487304 1:54786909-54786931 CTCTAAACTGAGAAGGAGCCTGG - Intronic
907595868 1:55719267-55719289 CTGAAACCAGAGAAGGAACCTGG - Intergenic
908191909 1:61712466-61712488 CAGTGAGCTGAGATCGCACCAGG - Intronic
909735262 1:78951161-78951183 CTGTAAGCTGAGATGGAACCTGG - Intronic
910418085 1:87022939-87022961 CTGTAAGCTGAGGTGGATGTAGG + Intronic
912738540 1:112172361-112172383 CTCTATGCTTTGATGGAACCTGG + Intergenic
912853075 1:113143821-113143843 CAGTAAGCTGAGATGCAGCCTGG + Intergenic
913996028 1:143652458-143652480 CTGTAAGCTCAGAGGGGAGCCGG - Intergenic
914831539 1:151174299-151174321 CTGGAAGGTGAGAGGGAAACTGG + Intronic
915096989 1:153470177-153470199 CTGAAACCTGAGAAGGGACCCGG + Intergenic
916202403 1:162284428-162284450 CTGGCAGCCGTGATGGAACCTGG + Intronic
918648353 1:186928245-186928267 ATGTAAGCTGTGAGGGAAACAGG + Intronic
920958262 1:210639533-210639555 CTCTCAGGTGAGATGCAACCTGG - Intronic
921352150 1:214246880-214246902 GTGTAGGCTGGGATGGAATCCGG + Intergenic
922613211 1:226945060-226945082 CTGAAAGCTGGGATGTAACGGGG - Intronic
923707332 1:236354813-236354835 CTTTAAACTGAGATGGAATTTGG - Intronic
1063405128 10:5786770-5786792 CTGTATGCTAAGATACAACCGGG + Intronic
1066420598 10:35261293-35261315 CTGTGAGCTGAGATCGCACCAGG - Intronic
1070076934 10:73145700-73145722 CCGTGAGCTGAGATTGCACCTGG - Intronic
1070947656 10:80407049-80407071 CTGTAAGTTTACATGGAACATGG + Intergenic
1074513666 10:114143198-114143220 CTTTGAGCTCAGATGAAACCAGG - Intronic
1077389582 11:2293904-2293926 CTGGAAGGTGAGATTGCACCAGG - Intergenic
1077463043 11:2720500-2720522 CTGTAAGGGGAGAGGGACCCAGG + Intronic
1078129032 11:8596651-8596673 CTGAATGATGAGAAGGAACCAGG - Intergenic
1078673897 11:13391176-13391198 CAGTAAGTAGATATGGAACCAGG - Intronic
1081011958 11:37824467-37824489 CTGTAAGGGGAAATGGAACACGG + Intergenic
1081685641 11:45041273-45041295 CTGAAAGGTGAGGTGGAACCTGG + Intergenic
1081717422 11:45260344-45260366 TTGAAAGATGTGATGGAACCAGG - Intronic
1086135311 11:83438450-83438472 CTGTAAGATATGTTGGAACCTGG - Intergenic
1087121404 11:94578202-94578224 TTGTAAGAGGAGATGAAACCTGG - Intronic
1089169615 11:116502939-116502961 TGGAAGGCTGAGATGGAACCAGG + Intergenic
1090624731 11:128596407-128596429 CAGTGAGCTGTGATGGCACCAGG + Intergenic
1091177476 11:133574888-133574910 ATATAAGGTGAGCTGGAACCTGG - Intergenic
1092844322 12:12569937-12569959 ATGTAATGTGAGATGGTACCAGG - Intergenic
1095684468 12:45016839-45016861 CAGTGAGCTGAGATTGCACCAGG - Intronic
1097158127 12:57027325-57027347 CTTTGAGCTGAGATAGAACCTGG - Intronic
1097628295 12:62028582-62028604 TTGTAAGCTAAGATGGATTCTGG - Intronic
1097772825 12:63608766-63608788 GTGATAGCTGAGATGGAACAGGG - Intronic
1098146416 12:67502314-67502336 CTGTGAGCTCAGCTGGACCCTGG + Intergenic
1098305819 12:69101633-69101655 CTGTAACGTGAGATGAAACATGG + Intergenic
1101815606 12:108143847-108143869 CGGAAAGCTGTGATGGCACCAGG + Intronic
1101995943 12:109524877-109524899 CTGTATGCTGAGAATGAACAAGG - Intronic
1111484385 13:88877074-88877096 CTGGAAGCTGAGATGCTACAGGG + Intergenic
1113724656 13:112588924-112588946 CTGCAACCTGAGCTGGACCCAGG - Intergenic
1113788040 13:113013054-113013076 CTGTGACCTGAGAGGAAACCAGG - Intronic
1114440971 14:22747381-22747403 CTGCCAGCTGAGGTGGAGCCTGG - Intergenic
1117680446 14:58198138-58198160 CAGTGAGCTGAGATCGAACCTGG + Intronic
1122286728 14:100656784-100656806 GTGTATGCTGAGATGCCACCAGG - Intergenic
1122969218 14:105145700-105145722 CTGCAAGCTCAGATGCCACCAGG + Intronic
1125750076 15:42021905-42021927 CTGAATGCAGGGATGGAACCTGG + Intronic
1126238241 15:46410295-46410317 CTGGAGTCTGGGATGGAACCAGG - Intergenic
1127183792 15:56455777-56455799 CTGTAATCAGAGAAGAAACCAGG + Intronic
1128729568 15:70011814-70011836 CTGGAAGCAGAGCTGGCACCAGG - Intergenic
1130011767 15:80157874-80157896 CTGGAAGCAGAGATGGCACAAGG + Intronic
1131543511 15:93296148-93296170 CAGTGAGCAGAGATGGCACCTGG + Intergenic
1134315232 16:13112884-13112906 CTGCAAGCTGAGATGGAATTAGG - Intronic
1134384363 16:13758153-13758175 CAGTAAGCTCTGAAGGAACCTGG - Intergenic
1135502663 16:23010715-23010737 TTTAAAGCTGAGATGGAGCCAGG - Intergenic
1136719664 16:32310176-32310198 CTCGCAGCTGGGATGGAACCCGG + Intergenic
1136838038 16:33516456-33516478 CTCGCAGCTGGGATGGAACCCGG + Intergenic
1137815271 16:51392444-51392466 GTGTAACCTGAGAGAGAACCCGG - Intergenic
1138127419 16:54450139-54450161 CTGAAAGGTGAGAAGGAACCAGG + Intergenic
1138405144 16:56786737-56786759 CTGTAAGCTAGGATGGAGCCAGG + Intronic
1139449166 16:67016443-67016465 CTGTAAGCTGGGAGGGAGCATGG + Intergenic
1139959238 16:70708270-70708292 GTGTAAGCTGAAAAGGAACCAGG - Intronic
1140075665 16:71696577-71696599 CAGTGAGCTGAGATTGCACCCGG + Intronic
1140164436 16:72535001-72535023 CTGGAAGCTGCTATAGAACCAGG - Intergenic
1141589996 16:85062025-85062047 CTCTGAGCTGAGATGGAAAGAGG - Intronic
1203006767 16_KI270728v1_random:207593-207615 CTCGCAGCTGGGATGGAACCCGG - Intergenic
1142744919 17:1951384-1951406 CAGTAAGGTGAGAGGAAACCAGG + Intronic
1144122635 17:12170790-12170812 CAGTGAGCTGAGATGGTGCCTGG - Intergenic
1145833733 17:27938010-27938032 CAGTGAGCTGAGATCGCACCAGG - Intergenic
1146187085 17:30731244-30731266 CAGAAAGCTGAGAAGGAATCCGG - Intergenic
1146332120 17:31936604-31936626 CAGAAAGCTGAGAAGGAATCCGG - Intergenic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1147571273 17:41572470-41572492 CTGTGAGCTGAGCTGGAACTAGG + Intergenic
1148784051 17:50136674-50136696 CTGGAAGCTGGGAGAGAACCAGG - Intronic
1149892945 17:60406234-60406256 CAGTGAGCTGAGATGGTCCCTGG - Intronic
1149930365 17:60747429-60747451 CTGTCAGTTGAGATGGAAATAGG + Intronic
1150789143 17:68186339-68186361 CTATAAGGTGATTTGGAACCAGG + Intergenic
1151825487 17:76521663-76521685 CAGTGAGCCGAGATGGCACCAGG - Intergenic
1152207345 17:78981191-78981213 CTCTAAGCTGCCAGGGAACCAGG - Intergenic
1152532949 17:80931147-80931169 CTGCAGGCGGAGGTGGAACCAGG - Intronic
1155146827 18:23091102-23091124 CAGTGAGCTGAGATGGCACCAGG - Intergenic
1157807757 18:50670859-50670881 CTGTTGTTTGAGATGGAACCTGG - Intronic
1157808994 18:50679807-50679829 CTGTGAGCAGAGATGGGGCCAGG + Intronic
1158102847 18:53850009-53850031 TTGTAAACTGAGATGAAACTAGG + Intergenic
1162147118 19:8619687-8619709 CAGAAAGCTGAGATTGCACCAGG - Intergenic
1164145399 19:22509785-22509807 CACTTAGCTCAGATGGAACCTGG - Intronic
1166834718 19:45660312-45660334 CAGTGAGCTGAGATCGCACCAGG + Intergenic
1167256796 19:48435345-48435367 CAGTGAGCTGAGATGGTGCCCGG - Intronic
1167707907 19:51092584-51092606 CAAGAAGCTGAGATGGAAACTGG - Intergenic
925565816 2:5253073-5253095 GAGGAAGCTGAGAGGGAACCTGG + Intergenic
926163665 2:10505053-10505075 CAGTCAGCTGAGATGGGACTGGG + Intergenic
928965575 2:36971750-36971772 CAGTGAGCTGAGATGGTGCCAGG - Intronic
928972328 2:37043223-37043245 CTGTAACAGGAGATGGAACATGG + Intronic
931081849 2:58782413-58782435 CAGTGAGCTGAGATGGTGCCTGG + Intergenic
933556474 2:83836623-83836645 CAGTGAGCTGAGATGGCGCCAGG + Intergenic
934052487 2:88222162-88222184 GTGTAAGCTGAGGGGGCACCAGG - Intergenic
935497717 2:103802375-103802397 CTGTAGGCTGATCAGGAACCTGG - Intergenic
937238629 2:120446143-120446165 CTGGAGGCTGAGGTGGAACCTGG - Intergenic
937251200 2:120524894-120524916 CTGTGAGGTCAGAGGGAACCAGG - Intergenic
938743423 2:134254099-134254121 CTGTAAGCTGAGGGGAAATCTGG - Intronic
942286845 2:174426888-174426910 CAGTGAGCTGAGATCGCACCAGG - Intronic
943785287 2:191870987-191871009 CTGAAAACAGAGATGGAACTGGG + Intergenic
944906787 2:204269775-204269797 ATGTCAGCTGAGGTGGAAACCGG + Intergenic
945266368 2:207895217-207895239 CTGTAAAATGAGAGTGAACCAGG + Intronic
947375515 2:229491105-229491127 GAGCAAGCTGAGAAGGAACCTGG - Intronic
1169000964 20:2167767-2167789 CAGTGAGCTGAGATGGTGCCAGG - Intronic
1169426174 20:5498948-5498970 CAGTGAGCTGAGATGAACCCAGG - Intergenic
1169989228 20:11482058-11482080 CTGAAAGGTAAGATGGAGCCAGG + Intergenic
1170566557 20:17611230-17611252 CTGGAGCCTGACATGGAACCTGG + Intergenic
1174082169 20:47978277-47978299 CTGTGAGCGGAGATGAAATCTGG + Intergenic
1174134313 20:48368509-48368531 CTGTGAGCGGAGATGAAATCTGG - Intergenic
1175583075 20:60115765-60115787 CTGTAAGCTAAAATGTCACCCGG - Intergenic
1175960405 20:62633482-62633504 CAGTGAGCTGAGATGGTGCCTGG + Intergenic
1178437777 21:32575112-32575134 CTGTCAGCTGAGATGATGCCTGG + Intergenic
1179476612 21:41650642-41650664 CTGGAAGTGAAGATGGAACCAGG - Intergenic
1180725833 22:17945922-17945944 CTGTAAGCTGAGAGAGCAGCTGG - Intronic
1181856571 22:25785405-25785427 CTGGAAGCACAGAAGGAACCAGG - Intronic
1182547241 22:31083371-31083393 CTGTCAGCTGAGAGGTACCCTGG - Intronic
1182660730 22:31923365-31923387 CTCTAAGCTGAGATAGAAACTGG + Intergenic
1182856194 22:33519533-33519555 CTGGAGCCTGAGAGGGAACCTGG - Intronic
950598566 3:14009277-14009299 CTGTAATAGGAGATGGAACACGG - Intronic
950759098 3:15204857-15204879 CTATAAGCTGTGATGGGAGCAGG + Intergenic
951529924 3:23688619-23688641 CAGTGAGCTGAGACTGAACCTGG + Intergenic
953812390 3:46124533-46124555 GTGTAAGAGGAGATGGAACATGG - Intergenic
955151416 3:56370901-56370923 CTGTAAGCTGCTTTAGAACCAGG - Intronic
956783215 3:72621052-72621074 CTGTGAGCTGAGATCACACCCGG - Intergenic
959149451 3:102591180-102591202 CTATAAGCTGAGATGTATCTGGG - Intergenic
960972709 3:123150993-123151015 CATTAAGCTGAGCTGTAACCTGG - Intronic
962535838 3:136328079-136328101 CTGGAAGCTGAGGTGGAGCTGGG - Intronic
963860841 3:150308676-150308698 ATGACAGCTGAGATGCAACCTGG - Intergenic
964405098 3:156340496-156340518 GTGTAGGGTGAGATGGAACCAGG - Intronic
966063754 3:175791330-175791352 CTGTGAGCTTAGCTGGAAGCAGG + Intronic
966998639 3:185310074-185310096 CTGAAAGCTGAGATTGGAGCAGG + Intronic
967440303 3:189500125-189500147 CTGTAAGCAGAGATCGGAGCAGG + Intergenic
968264704 3:197354019-197354041 AAGTAAGCTTAGATGGAGCCTGG + Intergenic
968738955 4:2317549-2317571 CTGGAGGCTGAGCTGGAACTTGG - Intronic
969097011 4:4741128-4741150 CATTAAGCTGACATGGAGCCTGG - Intergenic
969389892 4:6884726-6884748 CTGTAACAGGAGATGGAACATGG - Intergenic
969878476 4:10153865-10153887 GTGAAAGCTGATATGGGACCTGG + Intergenic
970175306 4:13333413-13333435 CATGAAGCTGAGATGGAAGCTGG + Intergenic
977201492 4:94121786-94121808 CTGAAAGCTGAGAAGGAGCAGGG - Intergenic
977557912 4:98503431-98503453 CTGGAAACTCAGAAGGAACCAGG + Intronic
978930283 4:114302550-114302572 CTGTAAGGTGAGATTGAAGTGGG + Intergenic
979748883 4:124251281-124251303 CTGTATGCTCAGCGGGAACCAGG - Intergenic
979894635 4:126144889-126144911 CTATGAGATGAGATGGAACAGGG - Intergenic
980273075 4:130612072-130612094 CAGTAAGCTGAGATTGTGCCAGG + Intergenic
983160422 4:164407071-164407093 CTGTGAGCTGGGATAGAACATGG + Intergenic
984268816 4:177525889-177525911 CAGTGAGCTGAGATCGTACCTGG - Intergenic
984536630 4:180983912-180983934 ATGGAAGCTGAGGTGGAAACAGG - Intergenic
987098147 5:14567924-14567946 CTGTAAGAAGACATGGAACTAGG + Intergenic
987424630 5:17758851-17758873 CTTTAACCTGAGGTTGAACCCGG - Intergenic
990330423 5:54719950-54719972 CTGTAAGCTGAGACTGACACTGG - Intergenic
990501905 5:56404969-56404991 CTATAAGGTTAGATGGGACCTGG + Intergenic
990615204 5:57500806-57500828 GTGTAAGCTGAGGAGGAGCCAGG + Intergenic
990818319 5:59809872-59809894 CTCTAGGCAGAGATGGACCCCGG - Intronic
992003127 5:72454310-72454332 CTGCAAGGTGCTATGGAACCTGG - Intronic
992698983 5:79320432-79320454 CTGTAATCCCAGATTGAACCCGG - Intronic
994559448 5:101348547-101348569 CAGTGAGCTGAGATGGCGCCTGG - Intergenic
995528711 5:113072062-113072084 CTGTACCCTGAGATGGAAAACGG - Intronic
997479058 5:134169327-134169349 CTCTAAGCTGAGATAGGATCAGG - Intronic
997605662 5:135174128-135174150 CTCTGTGCTGTGATGGAACCAGG + Exonic
998154413 5:139776265-139776287 CTGTAAGCTGGGATACAACCAGG + Intergenic
998379352 5:141713012-141713034 AGGTAACCTGAGCTGGAACCTGG - Intergenic
998989928 5:147804379-147804401 CTGGAAGCTGCGATTGAACCTGG + Intergenic
999957086 5:156714200-156714222 CTCCCAGCTGAGGTGGAACCAGG + Intronic
1001423218 5:171602726-171602748 CTGTAACAAGAGATGGAACATGG - Intergenic
1001805921 5:174586133-174586155 CAGTGAGCTGAGATCGCACCAGG - Intergenic
1001976536 5:176004565-176004587 ATGTAACCGGAGATGGAACATGG - Intronic
1002140143 5:177133244-177133266 CTGTAACCTAAGATGGAGGCCGG + Intronic
1002240892 5:177839207-177839229 ATGTAACCGGAGATGGAACGTGG + Intergenic
1002366606 5:178717404-178717426 CAGGAAGCTGAGAGGGAAACAGG + Intronic
1003441349 6:6145591-6145613 CAGGAAGCTGAGATGAACCCTGG - Exonic
1003601161 6:7518886-7518908 CGGTGAGCTGAGATCGAACCAGG - Intergenic
1004367498 6:15024283-15024305 CAGTAAGCTGAGATTGCGCCAGG + Intergenic
1007124217 6:39411305-39411327 CTGTAATAGGAGCTGGAACCAGG - Intronic
1017117953 6:150996625-150996647 CTGTAGGCTCAGCAGGAACCAGG - Intronic
1018795240 6:167180163-167180185 CTGTCAGCTGAGATGATGCCTGG - Intronic
1018821080 6:167374899-167374921 CTGTCAGCTGAGATGATGCCTGG + Intronic
1019904509 7:4051622-4051644 CCAGAAGCTGAGATGGAACAGGG - Exonic
1020228483 7:6298716-6298738 CAGTGAGCTGAGATGGAGCCTGG - Intergenic
1021559875 7:21958904-21958926 CAGTGAGCCGAGATTGAACCAGG + Intergenic
1022365409 7:29709901-29709923 GTGATAGCTGAGATGGAACAGGG + Intergenic
1022932389 7:35132460-35132482 GTGATAGCTGAGATGGAACAGGG - Intergenic
1023048782 7:36233973-36233995 CAGTGAGCTGAGATGACACCAGG - Intronic
1023402776 7:39802521-39802543 CAGTGAGCTGAGATCGCACCAGG + Intergenic
1026597585 7:71746870-71746892 CAGTAAGCTGAGATGGCACCAGG + Intergenic
1028979630 7:96953405-96953427 CTGTCAGCTGCGATGACACCTGG + Intergenic
1029583099 7:101450389-101450411 CTGGAAGATGAGCTGGTACCAGG + Intronic
1029642346 7:101829046-101829068 CTGGAAGATGAGTTGAAACCTGG + Intronic
1029828315 7:103225255-103225277 GTGATAGCTGAGATGGAACAGGG - Intergenic
1030616289 7:111741557-111741579 CTGTGAGCCCAGATGGTACCAGG - Exonic
1031058865 7:117026684-117026706 CTGTAAGCTTAGATGGTAGATGG - Intronic
1032288695 7:130566615-130566637 CTGTAAGCAGAGGTGGGCCCTGG - Intronic
1033185168 7:139220698-139220720 CAGTGAGCTGAGATTGCACCTGG - Intergenic
1033428693 7:141268705-141268727 TTGTAACAGGAGATGGAACCTGG + Intronic
1033611692 7:142969295-142969317 GTGGAAGCAGAGATGAAACCAGG - Intergenic
1035076919 7:156185696-156185718 CTGAAAGCTGAAGTGGATCCCGG - Intergenic
1036419803 8:8585068-8585090 CTGTATCCTGAGTTGCAACCTGG - Intergenic
1037292953 8:17370460-17370482 CAGTGAGCTGAGATTGCACCAGG + Intronic
1043168898 8:76939104-76939126 CAGTGAGCTGAGATGGCATCTGG + Intergenic
1045228772 8:100279644-100279666 CTGTAATCTGAGCTTGAACCTGG - Intronic
1048068232 8:130993945-130993967 CTGTAACAGGAGATGAAACCTGG - Intronic
1048856701 8:138692782-138692804 CTCCAGGCTGAGCTGGAACCAGG + Intronic
1048857890 8:138699645-138699667 CTGGAACCTGAGATGTAGCCTGG - Intronic
1049117247 8:140699645-140699667 ACGTAAGCTGACATGGAAGCAGG + Intronic
1049318235 8:141981060-141981082 GGGTAAGCTGAGCTGGAACATGG + Intergenic
1051342922 9:16128240-16128262 AAGTGAGCTGAGCTGGAACCAGG - Intergenic
1052953208 9:34230694-34230716 TGGTAAGCTGTGATGGCACCCGG + Intronic
1053461908 9:38277946-38277968 CAGCAAGTTGAGATGGAGCCCGG - Intergenic
1058471862 9:105287817-105287839 CTGTATGCTGAGAATGACCCAGG - Intronic
1061311511 9:129766320-129766342 CAGTGAGCTGAGATTGCACCAGG - Intergenic
1203448872 Un_GL000219v1:91364-91386 CTGTAACCTGACATGGAGACAGG - Intergenic
1185885573 X:3779440-3779462 CAGTGAGCTGAGATCGCACCTGG + Intergenic
1189311615 X:40022819-40022841 CTGTGAGCTCAGATGGAAAAAGG + Intergenic
1190492292 X:50994122-50994144 CTGTCTCCTGAGCTGGAACCTGG - Intergenic
1195478386 X:105314664-105314686 GAGTAAGCTAAGATGGAGCCAGG + Intronic
1196977403 X:121175342-121175364 CAGTGAGCTGAGATCGCACCTGG - Intergenic
1197509304 X:127351043-127351065 CTTTAAGCTGTGATTGAACTTGG - Intergenic
1197922368 X:131609016-131609038 CTGTAAGCTTTGAGGGAAGCAGG - Intergenic
1200704930 Y:6434580-6434602 CTGTAGGCTGACAAGGAACATGG + Intergenic
1201029181 Y:9730128-9730150 CTGTAGGCTGACAAGGAACATGG - Intergenic
1201056145 Y:9994207-9994229 CCTTAAGCTGAGAAGGAACTGGG - Intergenic
1202189944 Y:22231372-22231394 CATTAAGCTGAGAAGGAACTGGG + Intergenic