ID: 909737742

View in Genome Browser
Species Human (GRCh38)
Location 1:78985974-78985996
Sequence GTATATGTGGATATAAAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 989
Summary {0: 1, 1: 0, 2: 11, 3: 152, 4: 825}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909737739_909737742 3 Left 909737739 1:78985948-78985970 CCTTATAAGTGGGAGCTAAACAT 0: 14
1: 53
2: 86
3: 154
4: 358
Right 909737742 1:78985974-78985996 GTATATGTGGATATAAAGAAGGG 0: 1
1: 0
2: 11
3: 152
4: 825
909737734_909737742 23 Left 909737734 1:78985928-78985950 CCAAATAATGCCATGTTCTCCCT No data
Right 909737742 1:78985974-78985996 GTATATGTGGATATAAAGAAGGG 0: 1
1: 0
2: 11
3: 152
4: 825
909737738_909737742 4 Left 909737738 1:78985947-78985969 CCCTTATAAGTGGGAGCTAAACA 0: 19
1: 76
2: 132
3: 207
4: 344
Right 909737742 1:78985974-78985996 GTATATGTGGATATAAAGAAGGG 0: 1
1: 0
2: 11
3: 152
4: 825
909737736_909737742 13 Left 909737736 1:78985938-78985960 CCATGTTCTCCCTTATAAGTGGG 0: 3
1: 108
2: 297
3: 482
4: 592
Right 909737742 1:78985974-78985996 GTATATGTGGATATAAAGAAGGG 0: 1
1: 0
2: 11
3: 152
4: 825

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909737742 Original CRISPR GTATATGTGGATATAAAGAA GGG Intronic
905487440 1:38313106-38313128 GTACACATGGATATAAAGATGGG + Intergenic
905655300 1:39682849-39682871 GTATATGTGGTCATTAAGACTGG + Intronic
905708286 1:40079032-40079054 GTACACGTGAATATAAAGATGGG - Intronic
906888868 1:49685097-49685119 ATACATGTGGACACAAAGAAAGG - Intronic
907367095 1:53970956-53970978 GTACACATGGATACAAAGAAAGG - Intergenic
907721014 1:56972234-56972256 ATATTTCTGTATATAAAGAATGG + Intergenic
908495454 1:64689771-64689793 TGATAAGTGGATATAAAGAAAGG - Intronic
908819854 1:68074231-68074253 GTACATATGGATACAAAGAAGGG - Intergenic
908873447 1:68642145-68642167 ATATATGTATATATAAAAAAAGG + Intergenic
908888443 1:68816837-68816859 ATATATGAGGACACAAAGAAAGG - Intergenic
909001121 1:70218784-70218806 GTATCTGTGAATACAAAGAATGG - Intronic
909030859 1:70537856-70537878 GTATACATGGACATAAAGATGGG - Intergenic
909102017 1:71359486-71359508 GTAAATGTGAACACAAAGAAGGG - Intergenic
909170643 1:72289571-72289593 GTGTATGTGTATATATATAATGG - Intergenic
909224132 1:72994386-72994408 GTATATGAGGATGAGAAGAATGG - Intergenic
909305001 1:74062784-74062806 GTATATATGGATACAATGAAGGG + Intronic
909305471 1:74070428-74070450 GTACATATGGATACAAAGAAGGG + Intronic
909472520 1:76044228-76044250 GTTAATGTTGATATAAGGAAGGG + Intergenic
909548537 1:76873491-76873513 GTATGTATGGAAAGAAAGAAGGG + Intronic
909737742 1:78985974-78985996 GTATATGTGGATATAAAGAAGGG + Intronic
909872634 1:80762434-80762456 GTTTATATCTATATAAAGAAAGG - Intergenic
910568490 1:88674209-88674231 GTATGTATGCACATAAAGAATGG + Intergenic
910664700 1:89711927-89711949 GAATATGTGTAGAAAAAGAAGGG + Intronic
910957847 1:92726595-92726617 GGAAATCTGGATCTAAAGAAAGG + Intronic
911584621 1:99676580-99676602 GTATATATGGACATATAGAGTGG - Intronic
911703990 1:100989526-100989548 GTATTAGTGTATATAAACAAAGG - Intergenic
911776501 1:101820038-101820060 GTATTTGTGGATACAAGGATGGG - Intronic
912051849 1:105539635-105539657 GTATATGAGGATAAACAAAAAGG + Intergenic
912155687 1:106916110-106916132 GTATACATGGACATAAAGAAGGG + Intergenic
912234854 1:107838900-107838922 GTATATGTGGACATAAAGATGGG + Intronic
912483664 1:110006355-110006377 GTAGATGTAGATTTGAAGAAAGG + Intronic
912537956 1:110389850-110389872 GTACATATGGACATAAAGAGGGG + Intronic
912706218 1:111915928-111915950 GCAAAAGTTGATATAAAGAAAGG + Intronic
913137524 1:115907007-115907029 GTTGATGTGGATCTACAGAAAGG + Intergenic
913251803 1:116917920-116917942 ATATGTGTGCAGATAAAGAAAGG - Intronic
913353494 1:117890250-117890272 GTCTTTGGGGATACAAAGAAGGG - Intronic
913501461 1:119476181-119476203 GTATATGTGAGTACAGAGAATGG + Intergenic
914049224 1:144117799-144117821 GTATATGTAGACACAGAGAAGGG - Intergenic
914129960 1:144847646-144847668 GTATATGTAGACACAGAGAAGGG + Intergenic
915689352 1:157673040-157673062 GTACATATGGACACAAAGAAGGG - Intergenic
915946656 1:160157377-160157399 GTACATATGGACACAAAGAAGGG - Intronic
916461955 1:165034506-165034528 GGATATGTGGAGAGAATGAAAGG + Intergenic
916642192 1:166742433-166742455 GTACATGTGGTCACAAAGAAAGG + Intergenic
917039441 1:170788101-170788123 GAACATGTGGACACAAAGAAAGG + Intergenic
917384988 1:174462721-174462743 GTACATGTGAATATAAAGATTGG - Intronic
917411044 1:174760365-174760387 GTACACGTGGACACAAAGAAGGG - Intronic
917620108 1:176786877-176786899 GTATACATGGACACAAAGAAGGG + Intronic
917697416 1:177540348-177540370 GTACATATGGACACAAAGAAGGG + Intergenic
918156106 1:181848741-181848763 GTATACATGGATATACAGAGTGG + Intergenic
918276374 1:182957025-182957047 GTACATGTGAACACAAAGAAGGG + Intergenic
918725690 1:187919728-187919750 GTACATCTGGACACAAAGAAAGG - Intergenic
918741241 1:188133202-188133224 GTACAAATGGATATAAAGATGGG + Intergenic
919092796 1:192994511-192994533 GATTCTGTGGACATAAAGAAGGG - Intergenic
919245458 1:194977546-194977568 ATATACATGGATACAAAGAAGGG - Intergenic
919357776 1:196547667-196547689 TTATATGTAGATATAATGGATGG - Intronic
920062631 1:203238183-203238205 TTATGTGTAGAAATAAAGAAAGG - Intronic
920551308 1:206863522-206863544 GTATATACAGATATAAATAATGG + Intergenic
921395778 1:214667958-214667980 GTACATGTGGACATAAAGATGGG + Intergenic
921451888 1:215318385-215318407 GTATATGTTGAAAGAATGAATGG - Intergenic
921653308 1:217704589-217704611 GTACATATGGACACAAAGAAGGG - Intronic
921987258 1:221325815-221325837 GTACATATGGATATAAAGAAAGG - Intergenic
922130986 1:222777993-222778015 GTATTTGTGTATATAAACATAGG - Intergenic
922177344 1:223206856-223206878 TTATATGTGGATAACAGGAAAGG + Intergenic
922542701 1:226430881-226430903 GTACATGTGGACACAGAGAATGG + Intergenic
922982615 1:229840603-229840625 GTACATGTGGAAATAGAGTATGG + Intergenic
923802499 1:237223987-237224009 GTAGATGTGAATTTAGAGAATGG + Intronic
924819724 1:247477285-247477307 GTACATGTGGCCACAAAGAAGGG + Intergenic
1063819289 10:9816317-9816339 ATATATATGGACACAAAGAAGGG - Intergenic
1063832978 10:9977858-9977880 GTATACATGGACATAAAGATGGG + Intergenic
1064118688 10:12600815-12600837 GTACATGTGAACATACAGAATGG - Intronic
1064149579 10:12851291-12851313 GTACATGTGGACATAAAGATGGG - Intergenic
1064437119 10:15320161-15320183 GTATACATGGACACAAAGAAGGG - Intronic
1064598930 10:16973679-16973701 GTACATATGGACACAAAGAAGGG - Intronic
1064821048 10:19333335-19333357 GTAAATGTGGACATAAACATGGG - Intronic
1064835280 10:19520869-19520891 GTACATGTGGATGAATAGAAGGG - Intronic
1065457791 10:25925726-25925748 ATATATGTAGATATATAAAAAGG - Intergenic
1065997414 10:31071741-31071763 GTAGCTGTGGAAATAAAGCAAGG + Intergenic
1066333138 10:34447015-34447037 GTTTATATGGATAGAAAGCAAGG - Intronic
1067189123 10:44055005-44055027 GTACTTGTGGACATCAAGAAGGG + Intergenic
1067231457 10:44413979-44414001 GTACACATGGACATAAAGAAGGG - Intergenic
1067304480 10:45048195-45048217 GTATACATGGACATAAAGATGGG + Intergenic
1067367999 10:45654121-45654143 GTATATATGGAGACAAAGATGGG + Intronic
1067482817 10:46615778-46615800 GTATTTGTTGAAATAAATAATGG - Intergenic
1067611937 10:47725887-47725909 GTATTTGTTGAAATAAATAATGG + Intergenic
1068168823 10:53366715-53366737 GTTTGTGTGTATATACAGAAGGG - Intergenic
1068746888 10:60542523-60542545 GCAGATGTGGATAAAAAGAAAGG + Intronic
1068787117 10:60988494-60988516 GTACACATGGACATAAAGAATGG - Intronic
1068809366 10:61238579-61238601 GTATCTGTAGATATATAGATGGG + Intergenic
1069158747 10:65063620-65063642 GTATACATGGACATAAAGATGGG - Intergenic
1069349983 10:67513668-67513690 TTATATATGGCTATAATGAAAGG - Intronic
1069356541 10:67593007-67593029 GTACATATGGACACAAAGAAGGG - Intronic
1070013958 10:72505763-72505785 GTACATGTGGACATAAAGATGGG + Intronic
1070220878 10:74442794-74442816 GTATATGTATATATAAACAGTGG + Intronic
1070344215 10:75525825-75525847 GTAGCTGTGGATATTACGAAAGG - Intronic
1070361066 10:75689717-75689739 GTCTATGTGCAGATAATGAATGG - Intronic
1071539731 10:86469602-86469624 ATAAATGTGAATATAAAAAAAGG + Intronic
1071614973 10:87066961-87066983 ATATATGTGGAATTAAGGAAAGG - Intronic
1071830751 10:89369800-89369822 GTATATATGGATGGAAGGAAAGG + Intronic
1071830991 10:89372006-89372028 GTACATGTGGACACAAAGAAGGG + Intronic
1071905398 10:90168369-90168391 GTACATATGGACACAAAGAAGGG - Intergenic
1072422614 10:95301817-95301839 ATATATATGTATATAAATAATGG - Intergenic
1072644123 10:97238957-97238979 GTATTTGTGTATCTAAACAAAGG - Intronic
1072776661 10:98203250-98203272 GTGTATGTGTATGTAAAGAGAGG + Intronic
1072839785 10:98759137-98759159 GTATACATGGACACAAAGAAGGG + Intronic
1073163763 10:101424989-101425011 GTACACATGGACATAAAGAAGGG - Intronic
1073627702 10:105116837-105116859 GTACATATGGACACAAAGAAGGG + Intronic
1073658621 10:105446946-105446968 GTATAGGTGAACATAAAGACAGG - Intergenic
1073832309 10:107399189-107399211 GTACATATGGACACAAAGAAGGG - Intergenic
1074566508 10:114583920-114583942 GTACATATGGACATAAAGATGGG + Intronic
1074806996 10:117063866-117063888 GGATTTGGGGATATCAAGAAAGG - Intronic
1074965343 10:118486500-118486522 TTATGTATGGATACAAAGAAAGG + Intergenic
1075543441 10:123335341-123335363 GTACATATGGACACAAAGAAGGG - Intergenic
1075905033 10:126073564-126073586 GTACATATGGATGCAAAGAAGGG - Intronic
1075935427 10:126337058-126337080 GAATATGTGTATATAAAACAGGG + Intronic
1077780019 11:5317326-5317348 GTACACGTGGATATAAACATGGG - Intronic
1077812407 11:5651436-5651458 GTAGATATAGATACAAAGAAGGG - Intergenic
1077839275 11:5956854-5956876 GTATATTTAAATATAAAGAGAGG + Intergenic
1079572621 11:21963439-21963461 ATATATGTATATATAAATAAAGG + Intergenic
1079621646 11:22562775-22562797 GTACATGTGAACATAAAGATGGG - Intergenic
1079879988 11:25915063-25915085 GTACGTGTGGATATAAAAGAAGG + Intergenic
1079945600 11:26736963-26736985 GAATACGTGGATACAAAGAAGGG + Intergenic
1080016377 11:27510984-27511006 ATATATTTAGATATATAGAAAGG + Intergenic
1080198140 11:29635822-29635844 GTATCTGTGTATATGAAGAAAGG - Intergenic
1080479351 11:32629987-32630009 GGACATGTGGATCTAAACAAAGG + Intronic
1080658674 11:34278111-34278133 TGATATGTGAATATTAAGAAAGG - Intronic
1080955265 11:37086360-37086382 ATTTATTTTGATATAAAGAATGG - Intergenic
1081158368 11:39723146-39723168 GTACATCTGGATATAGAGATAGG + Intergenic
1081170284 11:39860164-39860186 CTATATGTAGATAGAAATAAAGG - Intergenic
1081180569 11:39981205-39981227 GTACATAAGGATACAAAGAAGGG - Intergenic
1081379982 11:42402660-42402682 GTACATATGGACACAAAGAAGGG + Intergenic
1081443551 11:43107097-43107119 GTACATTTGGACACAAAGAAGGG - Intergenic
1081903575 11:46651023-46651045 TTGTCTGTGGATATAAAGAATGG + Intronic
1082193111 11:49270761-49270783 GTATACATGGTTATAAATAATGG - Intergenic
1082221805 11:49647690-49647712 GTACATATGGATGCAAAGAAGGG + Intergenic
1082690879 11:56302992-56303014 GTACATGTGGACACAAAGAAGGG - Intergenic
1082859321 11:57839028-57839050 GTACATGTGGACACAAAGAAGGG + Intergenic
1082901125 11:58253655-58253677 GTACATATGGATATAGAGAGTGG - Intergenic
1083114739 11:60449721-60449743 GTACATATGGACACAAAGAAGGG + Intronic
1083495244 11:63046526-63046548 GTACATATGGACACAAAGAAGGG + Intergenic
1083966033 11:66044346-66044368 GTTTATGTAGAAATAAATAAGGG + Intronic
1085882831 11:80488019-80488041 GTAAAAGTGGACATAAAGATAGG - Intergenic
1085901681 11:80707809-80707831 GTATACATGGATACAAAGAAGGG + Intergenic
1085930744 11:81080096-81080118 GTACATGTGGATGTAAAGATGGG - Intergenic
1085988790 11:81814450-81814472 GTACATGTGCACACAAAGAAGGG + Intergenic
1086227623 11:84531277-84531299 GTACATATGGATACAAACAAGGG + Intronic
1086318468 11:85618564-85618586 GTATACATGGACATAAAGACAGG + Intronic
1086627224 11:88971470-88971492 GTACATATGGATGCAAAGAAGGG - Intronic
1086673018 11:89570306-89570328 GTATACATGGTTATAAATAATGG + Intergenic
1086746700 11:90437308-90437330 GTATATGTGGATATTTAAAATGG + Intergenic
1087302730 11:96454890-96454912 GTACATGTGGACATAATGATGGG - Intronic
1087358673 11:97129091-97129113 ATTGATGTAGATATAAAGAAAGG - Intergenic
1087382042 11:97417671-97417693 GTATATATGTATATATAGTACGG + Intergenic
1087417318 11:97873376-97873398 TTATATATGGATATAATGTAAGG - Intergenic
1087560988 11:99790364-99790386 GTACATCTGGACACAAAGAAGGG - Intronic
1087687555 11:101281669-101281691 ATATATATGGACACAAAGAAGGG - Intergenic
1087748326 11:101975775-101975797 GTACATATGGTCATAAAGAAGGG - Intronic
1087873124 11:103324362-103324384 GTATACATGGATACAAAGAAGGG - Intronic
1088005751 11:104937926-104937948 GTACACGTGGATAGAAAGATGGG + Intergenic
1088140759 11:106613400-106613422 TTAGACGAGGATATAAAGAAGGG + Intergenic
1088236805 11:107733538-107733560 GTACAGGTGGACATAAAGACAGG - Intergenic
1088556601 11:111067673-111067695 GTATATGTATATATACACAATGG + Intergenic
1088679721 11:112228729-112228751 GCAAATGTAGACATAAAGAATGG + Intronic
1090102288 11:123812010-123812032 GTACATGTGGACATAAAGATAGG - Intergenic
1090102355 11:123812708-123812730 GTATATATGGCCACAAAGAAGGG - Intergenic
1090727703 11:129542544-129542566 GTACACGTGGACACAAAGAAGGG - Intergenic
1090742661 11:129679690-129679712 GTACACATGGACATAAAGAAGGG + Intergenic
1091012680 11:132020024-132020046 GTAAATATGGACATAAAGATGGG - Intronic
1091161988 11:133432047-133432069 GTACATACGGACATAAAGAAGGG + Intronic
1091542457 12:1474382-1474404 GTATTGATGGGTATAAAGAAGGG - Intronic
1092029285 12:5270507-5270529 GTATATGTGTATATGAACAGAGG + Intergenic
1092740487 12:11623990-11624012 GTATACGTGTATGTAAATAAGGG - Intergenic
1092865899 12:12760716-12760738 CTATATGTGGATAAGAAAAAAGG + Intronic
1093100641 12:15024504-15024526 GTATACGTGGACACAAAGCAGGG - Intergenic
1093326040 12:17775218-17775240 GTAAAAGTGGAGATAAAGATGGG - Intergenic
1093344279 12:18021942-18021964 TTACATGTGGACAAAAAGAAGGG + Intergenic
1093500756 12:19809447-19809469 GTACATATGGATATAAAGATGGG + Intergenic
1093577360 12:20748645-20748667 GAATTTTTGGAGATAAAGAAAGG - Intronic
1093587040 12:20850695-20850717 GTACATATGGATACAAAGAAGGG - Intronic
1093590977 12:20902505-20902527 GTACATATGGACACAAAGAAGGG + Intronic
1094297268 12:28921561-28921583 GTACACATGGATATAAAGATGGG + Intergenic
1094386516 12:29900278-29900300 GTACATATGGACATAAAGAAGGG - Intergenic
1095152697 12:38814048-38814070 GTCTTTGAGGATAGAAAGAATGG + Intronic
1095253959 12:40011691-40011713 GTATACATGGACATAAAGATGGG - Intronic
1095486616 12:42691629-42691651 GTAAATTTGGATCAAAAGAAGGG - Intergenic
1095634574 12:44417775-44417797 GTACATATGGACACAAAGAAGGG - Intergenic
1096612240 12:52810056-52810078 GTACATGTGGACATAGAGCATGG + Intronic
1096963678 12:55606449-55606471 GTATACATGGACATAAAGATGGG + Intergenic
1097296525 12:57970729-57970751 GTATATATGTATATATATAATGG - Intergenic
1097481296 12:60129044-60129066 TTCTTTGTGGATATAAAGAAAGG + Intergenic
1097822911 12:64145754-64145776 GCCTCTGTGGCTATAAAGAAGGG - Exonic
1097939637 12:65289736-65289758 GTACACATGGATATAAAGAAAGG - Intronic
1098065174 12:66607045-66607067 GCACATGTGTGTATAAAGAAAGG + Intronic
1098396686 12:70026675-70026697 GTATATGTATATATATACAATGG + Intergenic
1098430363 12:70412719-70412741 GAAAATGTGCATATAAAGATGGG + Intronic
1098738323 12:74136724-74136746 CTATGTGTGGACATAAAGATGGG - Intergenic
1098832322 12:75377320-75377342 GGATATGTGCATATATGGAAGGG + Intronic
1098839230 12:75459039-75459061 GTACACATGGATATAAAGACGGG - Intergenic
1099252866 12:80279485-80279507 GTATATATGGAAACAAAGAGGGG - Intronic
1099371962 12:81845113-81845135 ATACATATGGATATAAAGATGGG - Intergenic
1099480782 12:83163206-83163228 GTAAATGTGGAAATAGAAAAAGG - Intergenic
1099625060 12:85061962-85061984 GTTCATGGTGATATAAAGAAAGG - Intronic
1099626769 12:85085627-85085649 GTATGTATGGACATAAAGATGGG - Intronic
1099768865 12:87026571-87026593 GTACATGTGGAAATAAAGAGGGG + Intergenic
1100033629 12:90223823-90223845 GTATATATGTATATAAACAATGG + Intergenic
1100129098 12:91468270-91468292 GTACATGTGAACACAAAGAAGGG - Intergenic
1100179883 12:92073694-92073716 GTACATTTGGACACAAAGAATGG - Intronic
1100191133 12:92193076-92193098 GAATATATGGGTATAAAGTAAGG + Intergenic
1100454514 12:94739418-94739440 GTACATGTGGACACAAAGAAGGG - Intergenic
1100637891 12:96453272-96453294 GTACATGTGGACATAAAGATAGG + Intergenic
1100764074 12:97844072-97844094 GTAAATGTGGAGTTAAAGATGGG - Intergenic
1100962304 12:99976149-99976171 GCATATGTGGACATAAATAAGGG + Intronic
1101220787 12:102637624-102637646 GTATACATGGACATAAAGATGGG - Intergenic
1101323651 12:103696112-103696134 GTATATGTAAATATGAACAAAGG + Intronic
1101972877 12:109329077-109329099 GAGTTTGTGCATATAAAGAAAGG - Intergenic
1103111022 12:118278332-118278354 GTACATTTGGATACAAAGAAGGG - Intronic
1103306006 12:119964631-119964653 GGATAAGTGGATATACAAAATGG - Intergenic
1103329081 12:120141424-120141446 GTGTATTTGGCTCTAAAGAAGGG - Intronic
1103777553 12:123377568-123377590 ATATGTGTGTATATAGAGAAAGG + Intergenic
1104214349 12:126721506-126721528 GTATAAGTGCTTATAAACAATGG - Intergenic
1104243219 12:127011517-127011539 GTATATATGTTTATAAAAAAGGG - Intergenic
1104313591 12:127676593-127676615 GTATAGATGGATATAAATAGAGG + Intergenic
1104409375 12:128545160-128545182 GTACATGTGGTTATAAAGATGGG - Intronic
1105313437 13:19234925-19234947 GTACACGTGGACAAAAAGAAAGG + Intergenic
1105379716 13:19875774-19875796 GTACACATGGATATAAAGATAGG + Intergenic
1105971855 13:25436300-25436322 GTACACGTGGACATAAAGATGGG - Intronic
1105979677 13:25505842-25505864 GTATAGGAGAATATAAAGGAAGG - Intronic
1106246135 13:27952057-27952079 GTAAAAGAGGATATGAAGAAAGG + Intergenic
1106271565 13:28159404-28159426 GTATACATAGACATAAAGAAGGG + Intronic
1106318440 13:28616093-28616115 GTACATATGGACATGAAGAAGGG - Intergenic
1106531144 13:30593000-30593022 GTACATATGGACATAAAGATGGG - Intronic
1106784098 13:33090090-33090112 GTATATGTCTATATATAGATAGG + Intergenic
1106868623 13:33994880-33994902 GTGTACGTGTATATAAAGTATGG - Intergenic
1106987031 13:35365801-35365823 ATATATGTTGTTATAAAAAAAGG - Intronic
1107176134 13:37400954-37400976 GTATGTATGGACACAAAGAAGGG + Intergenic
1107236512 13:38177006-38177028 GGATATATGTATATATAGAAGGG - Intergenic
1107739552 13:43434647-43434669 GTTTCTGTGGATTTAAAAAATGG + Intronic
1108007582 13:45966859-45966881 GTATGAGTGGGTACAAAGAAGGG + Intronic
1108101054 13:46956372-46956394 GTATATGTGGAGAAGAAGACAGG - Intergenic
1108228226 13:48312418-48312440 GGATATGTTGATTTCAAGAAAGG + Intronic
1108349250 13:49575691-49575713 GTACACGTGGATATAAAGACAGG + Intronic
1108544785 13:51481974-51481996 GTATATGTGGATGTGGAGAATGG - Intergenic
1108641913 13:52390956-52390978 TTATATGTATATATAAATAATGG + Intronic
1108800249 13:54086390-54086412 GTATATATGGACACCAAGAAGGG - Intergenic
1109186339 13:59273221-59273243 GTATACATGGACATAAAGATGGG + Intergenic
1109437565 13:62325956-62325978 GTATATATGGACACAAAGAAGGG - Intergenic
1109453855 13:62556694-62556716 GTGCATTTGGATATAAAGATGGG + Intergenic
1110020711 13:70466780-70466802 GTACACATGGATACAAAGAAGGG - Intergenic
1110050899 13:70897755-70897777 GTACAAGTGGACAAAAAGAAGGG - Intergenic
1110068152 13:71135646-71135668 GTGTGTGTGGATATAATAAATGG + Intergenic
1110091379 13:71452534-71452556 GTATATGTGGATAGTAGAAAGGG - Intronic
1110171816 13:72510378-72510400 GTATATCTGGTGGTAAAGAAGGG - Intergenic
1110230289 13:73160990-73161012 GTACATATGGACATAAAGAAAGG + Intergenic
1110442711 13:75543131-75543153 GTATACATGAACATAAAGAAAGG + Intronic
1110482079 13:75990502-75990524 GTATGTATGGACACAAAGAAGGG + Intergenic
1110668902 13:78153139-78153161 TTATAAGTGGATATAAATATAGG + Intergenic
1110674844 13:78229617-78229639 GTATATATGGACATAAATAATGG + Intergenic
1110732977 13:78902347-78902369 GTACATATGGACACAAAGAAGGG + Intergenic
1110829981 13:80019568-80019590 GTATGTATGGACACAAAGAAGGG + Intergenic
1111018158 13:82407725-82407747 GTACACGTGGACATAAAGATGGG - Intergenic
1111059820 13:83001593-83001615 ATACATATGCATATAAAGAAGGG - Intergenic
1111252989 13:85628961-85628983 GTATATATATATATAATGAAAGG - Intergenic
1112651598 13:101405133-101405155 GTAAATGTGCATATAGGGAAAGG - Intronic
1113009745 13:105750315-105750337 ATTTATGTGGATATGAGGAAAGG + Intergenic
1113202387 13:107881130-107881152 GTACATGTGGACACAAAGAGAGG + Intergenic
1113234211 13:108251652-108251674 GTACATGTGGACACAAAGAAGGG - Intronic
1113239254 13:108318101-108318123 GTACACGTGGACACAAAGAAGGG - Intergenic
1113247806 13:108418006-108418028 GCACATGTGGACACAAAGAAAGG - Intergenic
1113259414 13:108545194-108545216 GTACATATGGACACAAAGAAGGG - Intergenic
1113397118 13:109958180-109958202 GTACATATGGACAAAAAGAAGGG - Intergenic
1113538524 13:111086959-111086981 GTACATGTGAACACAAAGAAAGG - Intergenic
1114159661 14:20150358-20150380 GTACATATGGACACAAAGAATGG + Intergenic
1114381970 14:22215648-22215670 GTATGTGTGGATATCATAAATGG + Intergenic
1114395699 14:22358329-22358351 GTACATATGGATAAAAAGATGGG - Intergenic
1114594849 14:23902876-23902898 GTACATATGGATACAAAGAAGGG - Intergenic
1115013796 14:28585072-28585094 GTACATATGGACACAAAGAAGGG - Intergenic
1115413810 14:33107445-33107467 GTATACGTGGACATAAAGATGGG - Intronic
1115479524 14:33847772-33847794 GTATACATGGATGTACAGAATGG + Intergenic
1115558679 14:34563639-34563661 CTTTATGTGTATATAATGAATGG - Intronic
1116110833 14:40578526-40578548 GGATAAGTGGATGGAAAGAAAGG + Intergenic
1116126772 14:40798284-40798306 ATATTTGTGGCTATAAAGAAGGG + Intergenic
1116482554 14:45409086-45409108 GTATACATGGACATAAAGAAGGG - Intergenic
1116627386 14:47282775-47282797 ATACATGTGAATATTAAGAATGG + Intronic
1116648359 14:47559279-47559301 GTATATATGGACACAAAGAAGGG - Intronic
1117080236 14:52144129-52144151 GTACACGTGGACACAAAGAAGGG - Intergenic
1117210138 14:53488848-53488870 GTATATATAGATATATACAATGG + Intergenic
1117839000 14:59838139-59838161 GTATACATGGACATAAAGACAGG - Intronic
1117921350 14:60728138-60728160 GTACATGTGGACATAAAAATGGG + Intergenic
1118150640 14:63185786-63185808 GTATATTAGGATAAAAGGAAAGG - Intergenic
1118197107 14:63637586-63637608 ATATATGTGTATATATATAATGG + Intronic
1118214461 14:63795506-63795528 GTATATATGTATATATATAAAGG - Intergenic
1118216598 14:63814516-63814538 TTATATATGGATATATATAATGG - Intergenic
1118598812 14:67457080-67457102 GTACACATGGACATAAAGAAGGG + Intronic
1118649981 14:67881108-67881130 GTATTTGTGTATCTAAACAAAGG + Intronic
1119095428 14:71825748-71825770 ATATATATGGAAATAAGGAAAGG + Intergenic
1119139341 14:72251660-72251682 AAATATGTGGACATAAAGATGGG + Intronic
1120117033 14:80631510-80631532 TTATCTTTGAATATAAAGAATGG - Intronic
1120752435 14:88210345-88210367 GGATATGTGGCAATAAACAAGGG - Intronic
1121132788 14:91463950-91463972 GTACACATGGAAATAAAGAAGGG - Intronic
1121339331 14:93095785-93095807 GTATATATGGACACAAAGATGGG - Intronic
1121681378 14:95795363-95795385 GGATCTGTGGATAAAAATAAGGG - Intergenic
1122068124 14:99187859-99187881 TTTTTTGTGGATTTAAAGAAAGG - Intronic
1123769669 15:23516132-23516154 GTACATATGGACACAAAGAAGGG - Intergenic
1124501727 15:30233835-30233857 GTATATGTGAGCATAAAGATGGG - Intergenic
1124741838 15:32304816-32304838 GTATATGTGAGCATAAAGATGGG + Intergenic
1126292288 15:47095409-47095431 GTATATATGTATATACACAATGG + Intergenic
1126502491 15:49361436-49361458 GTACATGTGGACACAAAGAAGGG - Intronic
1126839150 15:52699331-52699353 GAATATTTGGCTAGAAAGAAAGG + Intronic
1128195447 15:65750285-65750307 GTATACCTGGACATAAAGATAGG + Intronic
1130189267 15:81716489-81716511 GTACACGTGGACACAAAGAAGGG - Intergenic
1130189471 15:81719142-81719164 GTACACATGGATACAAAGAAGGG - Intergenic
1130365649 15:83235912-83235934 GTATATGTACATATCAAGCAAGG - Intergenic
1131475110 15:92731778-92731800 GTACATGTGGAGATGAAGAAGGG + Intronic
1131959952 15:97779466-97779488 GTATATGCGGACACAAAGAAGGG + Intergenic
1132290419 15:100697327-100697349 GACTATGTGGATATAAAAATTGG + Intergenic
1132811728 16:1802587-1802609 GTTTATGAGGATATGAGGAAGGG + Intronic
1133839792 16:9397358-9397380 GTACATGTGGACACAAAGAAGGG + Intergenic
1133910660 16:10063176-10063198 GTATACATGGATATAAAAATGGG + Intronic
1134418328 16:14063543-14063565 GCAGATGTGGACACAAAGAAGGG - Intergenic
1134793731 16:17014768-17014790 GTATATATGGACACAAAGAAGGG - Intergenic
1134841774 16:17407325-17407347 ATATATGTGTATATATATAAGGG + Intronic
1135149830 16:19995716-19995738 GTACACGTGGACACAAAGAAGGG - Intergenic
1135284761 16:21183905-21183927 GTACATATGGAAATAAAGATGGG + Intergenic
1135733809 16:24915292-24915314 GCATGTGTGGATGTAAAGGAGGG + Intergenic
1135785008 16:25340741-25340763 GTAAGTGTGGACATAAAGATGGG - Intergenic
1135852294 16:25975243-25975265 GTATACATGGACACAAAGAAGGG + Intronic
1135854994 16:26001332-26001354 GTCTATGTGAATATACATAAAGG + Intronic
1136646020 16:31616191-31616213 GTACATATGGACATAAAGATGGG + Intergenic
1136659239 16:31741012-31741034 GTACATATGGACATAAAGATGGG - Intronic
1136678011 16:31931924-31931946 GTATGTATGGATACAAAGAAGGG + Intergenic
1137438258 16:48476138-48476160 GAACATGTGGACATAAAGAAGGG + Intergenic
1137973818 16:53013027-53013049 GTATAAATGGACATAAAGACTGG + Intergenic
1138218735 16:55230467-55230489 TTATATCAGGAAATAAAGAATGG + Intergenic
1138268023 16:55674225-55674247 GTACACATGGACATAAAGAAAGG - Intronic
1138760666 16:59540100-59540122 GAACACGTGGATATAAAGAGAGG + Intergenic
1139229442 16:65269263-65269285 GTACACGTGGACATAAAGATGGG - Intergenic
1139326803 16:66158868-66158890 GTATATATATATATAAAGATAGG - Intergenic
1140591803 16:76362702-76362724 GTGCATATGGAGATAAAGAAGGG + Intronic
1140942121 16:79731948-79731970 GTACACGTGGACACAAAGAAGGG + Intergenic
1141937374 16:87250066-87250088 GTATGTATGGACAAAAAGAAGGG + Intronic
1203137984 16_KI270728v1_random:1741668-1741690 GTATATGTAGACACAGAGAAGGG + Intergenic
1143419050 17:6775228-6775250 GTACACATGGATACAAAGAAGGG + Exonic
1143849347 17:9798185-9798207 GAATATGTGTATATAAAGCATGG - Intronic
1143982988 17:10886030-10886052 GTATTCATGGACATAAAGAAGGG - Intergenic
1144121786 17:12161850-12161872 GTACATATGGACATAAAGATGGG - Intergenic
1144153825 17:12478337-12478359 GTATATGTGTATATACACGATGG - Intergenic
1144413158 17:15020971-15020993 GTACACGTGGACACAAAGAAGGG + Intergenic
1144594739 17:16559486-16559508 GAATATGGGAATATAAAAAATGG + Intronic
1145046346 17:19619985-19620007 GTATATCAGCATATAAATAATGG - Intergenic
1145855130 17:28148272-28148294 GTGCATGTGTATATAAAAAAAGG - Intronic
1147118438 17:38320351-38320373 GTTTTTGTTGATTTAAAGAAGGG + Intronic
1149014834 17:51896280-51896302 GCATATGTGGACACAAAGAAGGG - Intronic
1149090449 17:52772072-52772094 GTACATATGGATACAAAGAAGGG + Intergenic
1149941923 17:60879325-60879347 TTATATGTGAATACAATGAAGGG + Intronic
1149951494 17:60992479-60992501 GTATACATGGACATAAAGATGGG + Intronic
1150120989 17:62602486-62602508 GCTCATGTGTATATAAAGAATGG + Intronic
1150121040 17:62602941-62602963 ATATTGGTGTATATAAAGAATGG + Intronic
1150537666 17:66060091-66060113 GTATATATGGACATAAAAACAGG + Intronic
1150719514 17:67602536-67602558 AAAGATGTGGATATAAAGTAGGG + Intronic
1150855947 17:68752932-68752954 GTATACATGGACATAAAGATGGG - Intergenic
1151126204 17:71847421-71847443 GGATATGTGGATATTAACATGGG - Intergenic
1151244215 17:72781965-72781987 GTATATGTATATATAGAGAGAGG - Intronic
1152814732 17:82400635-82400657 ATATATATGTATATAAATAAAGG - Intronic
1153333001 18:3893092-3893114 GTACACGTGGACATAAAGAATGG - Intronic
1154395712 18:13986762-13986784 GTACATGTGGACACAAAGAAGGG + Intergenic
1154503581 18:15009896-15009918 CTACACGTGGATATAAAGAAGGG + Intergenic
1155633611 18:27924172-27924194 GTTTATGTGGATTTTAAAAATGG + Intergenic
1156317070 18:35979818-35979840 GTAAATGTGTATATACACAATGG + Intergenic
1156572565 18:38274972-38274994 GTACACGTGGACACAAAGAAGGG + Intergenic
1156826688 18:41438320-41438342 GTACATATGGACACAAAGAAGGG - Intergenic
1157073567 18:44439090-44439112 GTACACATGGATATAAACAAGGG - Intergenic
1157206668 18:45706425-45706447 GTATACATAGACATAAAGAAGGG + Intergenic
1158078421 18:53560014-53560036 GTAGATGTGGATATAAACATGGG + Intergenic
1158126935 18:54110460-54110482 GTATACATGGATGTAAAGAAGGG - Intergenic
1158257946 18:55574184-55574206 TTCTATGTGAATATAAAGGAAGG - Intronic
1158768572 18:60486332-60486354 ATACATGTGGACACAAAGAAGGG + Intergenic
1158775939 18:60579751-60579773 GTATATGTGTATATATAGAGAGG + Intergenic
1159046769 18:63376106-63376128 GTAGATGTGGCTATAAAAATGGG + Intergenic
1159136197 18:64339656-64339678 GTATATGTGAAAATGACGAATGG + Intergenic
1159171059 18:64767445-64767467 GTACATGTGGACACAAAGAAAGG - Intergenic
1159648407 18:70947639-70947661 GTACACGTGGAGAAAAAGAATGG + Intergenic
1160005909 18:75069039-75069061 TTATAATTGGAGATAAAGAAAGG + Intergenic
1160606529 18:80054960-80054982 GTACATATGGACATAGAGAATGG + Intronic
1164149172 19:22533503-22533525 GTAAATATGGAGAAAAAGAAGGG - Intergenic
1164155579 19:22595168-22595190 GTAAATATGGAGAAAAAGAAGGG + Intergenic
1164442207 19:28287843-28287865 GTTCATGTGGACATAGAGAATGG + Intergenic
1164544717 19:29150673-29150695 GTTTGTGTTGATATATAGAATGG - Intergenic
1164951710 19:32343016-32343038 GTATACATGGACATAAAGAAGGG + Intergenic
1165424012 19:35735839-35735861 GTAGATGTGGATGTGAAGAAGGG - Intronic
1165691201 19:37865018-37865040 GGATATATAGATATATAGAAAGG - Intergenic
1168502341 19:56903972-56903994 GTATATGTGTGTATATAGATGGG - Intergenic
925489843 2:4378730-4378752 GTATACATGGACATAAAGATGGG - Intergenic
925746065 2:7044816-7044838 GCACCTGTAGATATAAAGAATGG - Intronic
925810928 2:7699695-7699717 GTATACGTGGACACAAAGAAGGG - Intergenic
926347503 2:11961627-11961649 GTACACATGAATATAAAGAAGGG + Intergenic
926377094 2:12241885-12241907 GTATATGTGCCTATAAGGAAAGG + Intergenic
926453165 2:13031764-13031786 GAATATGTATATATAAAAAATGG + Intergenic
926901525 2:17755611-17755633 GTATATATTCATATAAAGACTGG - Intronic
927605156 2:24480297-24480319 GAATATGTGGACACAAAGAGGGG - Intergenic
928055988 2:28055215-28055237 GTATATGTGGATACAAAAAAGGG + Intronic
928357715 2:30635219-30635241 GTATATATATATATAAAGACAGG - Intronic
928597748 2:32872292-32872314 GTACATATGGACATAAAGATGGG + Intergenic
928782175 2:34836947-34836969 GTACATGTTGATGTAAAGATGGG + Intergenic
929037150 2:37705119-37705141 GAAAATGAGGATTTAAAGAATGG - Intronic
929135635 2:38621382-38621404 GTATACATGGACATAAATAAAGG + Intergenic
929207827 2:39318198-39318220 GTACACATGGATACAAAGAAGGG + Intronic
929324419 2:40590836-40590858 GTATATGTAAAATTAAAGAAAGG - Intronic
929374587 2:41269770-41269792 GGATATATGGATATATAAAAGGG - Intergenic
929681456 2:43996691-43996713 GTATATGTGCATTTACTGAAGGG - Intergenic
930047289 2:47183958-47183980 GTGTATGTGTGTATAGAGAAAGG - Intergenic
930500273 2:52207679-52207701 ATATATCTGAATATAAAGACGGG - Intergenic
930515082 2:52396654-52396676 GTTTATGTGGCAATAAATAAAGG + Intergenic
930791204 2:55330732-55330754 AAATATGTGGAAATAATGAATGG + Intronic
930965527 2:57319558-57319580 GTAAATATGGATATAAAGAAGGG + Intergenic
931442048 2:62296946-62296968 GTATGTGTGGATACGAAGTAGGG + Intergenic
931528090 2:63180379-63180401 GTACATATGGACATAAAGTATGG - Intronic
931557896 2:63525198-63525220 GTACATATGGACACAAAGAAGGG + Intronic
931788380 2:65641938-65641960 CTATATGTGTATATAAAGGTAGG - Intergenic
931903638 2:66819711-66819733 GTATATATGGACAAAAAGAGGGG - Intergenic
932087246 2:68773453-68773475 GTATACGTGGACATAAATATGGG + Intronic
932507808 2:72253649-72253671 GTACATATGGACACAAAGAAGGG + Intronic
932827151 2:74951990-74952012 ATATATGTGGACACAAAGAAGGG + Intergenic
932880598 2:75498282-75498304 GTAAACGTGGACATAAAGAAGGG + Intronic
932971544 2:76549363-76549385 GAAGATGTGGAAATAAATAAAGG + Intergenic
933168963 2:79104262-79104284 GTACATATGGACACAAAGAAAGG + Intergenic
933449290 2:82426034-82426056 GTATTTGTGGCTATAAATATAGG + Intergenic
933515939 2:83301818-83301840 GTATACATGGACATAAAGATGGG - Intergenic
933730846 2:85455249-85455271 GTATATGGGCATAGAAAGACAGG + Intergenic
933957756 2:87385392-87385414 GTATATGTAGACACAGAGAAGGG + Intergenic
934241877 2:90277309-90277331 GTATATGTAGACACAGAGAAGGG + Intergenic
934271295 2:91539379-91539401 GTATATGTAGACACAGAGAAGGG - Intergenic
934507754 2:94907620-94907642 ACATATGTGGACACAAAGAAGGG + Intergenic
934692668 2:96373637-96373659 CTATACATTGATATAAAGAATGG - Exonic
934708085 2:96498615-96498637 GAATATATGTATATAAAAAATGG - Intronic
935591809 2:104852099-104852121 GTATATGTATATATAAAAGATGG - Intergenic
935726416 2:106027855-106027877 GTATACGTGGATACACAGAGTGG + Intergenic
935877630 2:107528670-107528692 GTATACATGGATACAAAGATGGG + Intergenic
936292343 2:111235911-111235933 GTTTATGTGAATATAATCAAAGG + Intergenic
936526124 2:113242620-113242642 GTATATGTGGGTATGCTGAAGGG + Intronic
937582144 2:123499960-123499982 ATATATATGGATATATATAAAGG + Intergenic
937701840 2:124871247-124871269 GTATATGTATGTATAATGAAGGG - Intronic
938502755 2:131840027-131840049 CTACACGTGGATATAAAGAAGGG + Intergenic
939309797 2:140461449-140461471 AAATATGGGGAGATAAAGAATGG - Intronic
939369201 2:141276485-141276507 GTACATATGGACACAAAGAAGGG - Intronic
939468051 2:142583541-142583563 GTATATTTGGAGAAAAAAAAAGG - Intergenic
939650645 2:144757923-144757945 GTATATATGGACACAATGAAGGG - Intergenic
939749932 2:146031634-146031656 GTATGTATGTATATATAGAAAGG + Intergenic
939915842 2:148042198-148042220 ATCTATGTGGATATAAATAGTGG + Intronic
940383997 2:153049043-153049065 GTACATATGGACATAAAGATGGG + Intergenic
940531447 2:154882836-154882858 GTATGCATGGACATAAAGAAAGG - Intergenic
940711478 2:157167404-157167426 GTATATATGTATATATAAAAGGG + Intergenic
941129864 2:161634306-161634328 GTATATCCTGATATAAAGAAAGG - Intronic
941267619 2:163382445-163382467 GCATATGTGGACATAAACATGGG - Intergenic
941391818 2:164924269-164924291 GTACATGTGGATATAAAGATGGG + Intronic
941639072 2:167967982-167968004 GTACACATGGATACAAAGAAGGG - Intronic
942100220 2:172573468-172573490 GTATATGTGTATATATATATAGG + Intronic
942809982 2:179987414-179987436 GTAGATGTGTATATAAAATATGG - Intronic
943124311 2:183777432-183777454 GTATATATGCATGTAAAGATAGG - Intergenic
943124468 2:183779456-183779478 GTACACGTGGACACAAAGAAGGG - Intergenic
943171678 2:184408807-184408829 GTACATGTGGATAGAGAGAGTGG + Intergenic
943413871 2:187573769-187573791 GTACATATGGACACAAAGAAGGG - Intergenic
944034095 2:195272079-195272101 ATATATATGGAATTAAAGAACGG + Intergenic
944318732 2:198311336-198311358 CCATATGTGGAGATAAAGCAGGG - Intronic
944366725 2:198929480-198929502 CTAGATGTGGATACAAAGAGTGG - Intergenic
944437096 2:199702090-199702112 GTACATATGGATACAGAGAAGGG + Intergenic
944493563 2:200283384-200283406 GTATATGTGAATTTGGAGAAAGG + Intergenic
944900622 2:204211366-204211388 GTAAATGTTGATATAACCAATGG - Intergenic
945104288 2:206294684-206294706 GTACATGTGGACATAAAGATGGG - Intronic
945556143 2:211278898-211278920 ATAATTGTGGATATCAAGAATGG - Intergenic
945623622 2:212172564-212172586 GTATATGTGTATATACACCATGG + Intronic
945712668 2:213318453-213318475 GTACATATGGACATATAGAATGG + Intronic
945909320 2:215629693-215629715 GTACATATGGACACAAAGAAGGG - Intergenic
946030225 2:216697837-216697859 TTCTAAGTGGAGATAAAGAATGG - Intergenic
946218857 2:218208824-218208846 GTATATATGGACACAAAGAAGGG - Intergenic
946441548 2:219701176-219701198 GTACACATGGATATAAAGATGGG - Intergenic
946878336 2:224152436-224152458 GTACATGTGGACACAAAGAAGGG - Intergenic
947246046 2:228049686-228049708 GTACATATGGACATAAAAAATGG - Intronic
947370044 2:229436138-229436160 GTACATATGGACACAAAGAAGGG - Intronic
948679400 2:239622578-239622600 GTACACGTGGACATAAAGATGGG - Intergenic
1169024650 20:2358896-2358918 GTATACATGGACACAAAGAAGGG - Intergenic
1169514686 20:6303086-6303108 GTACACATGGATACAAAGAAGGG - Intergenic
1169861399 20:10156577-10156599 GTACACGTGGGTATAAAGATGGG - Intergenic
1169996468 20:11563153-11563175 GCACATGTGGACATAAAGATGGG + Intergenic
1170664108 20:18371271-18371293 GTACATGTGGACATAGAGAGTGG + Intergenic
1170751867 20:19155741-19155763 GTATATGTGTATCTAAACATAGG + Intergenic
1171117916 20:22542516-22542538 GTACATATGGACACAAAGAAGGG - Intergenic
1171949716 20:31410312-31410334 GTACATGTGAACATAAAGAGGGG + Intronic
1173112825 20:40209912-40209934 GTACATGTGGACATAAAGATAGG + Intergenic
1173253877 20:41379233-41379255 GTATATGTATATATAGAGAGAGG - Intergenic
1173492601 20:43495324-43495346 ATATATGTATATATAAAAAAGGG + Intergenic
1173712355 20:45170952-45170974 GTACATATGGACACAAAGAAGGG + Intergenic
1173961497 20:47075892-47075914 GTACACATGGATACAAAGAAGGG - Intronic
1175182249 20:57156920-57156942 CTAGATTTGGAAATAAAGAACGG - Intergenic
1175450853 20:59065920-59065942 AATTATGTGGATATCAAGAAAGG + Intergenic
1176719566 21:10382128-10382150 ATATACGTGGATATAAACATGGG + Intergenic
1176984328 21:15419086-15419108 GTAGCTGTGGATATAGAGATAGG + Intergenic
1178060266 21:28845985-28846007 GTACATATGGACACAAAGAAGGG - Intergenic
1178141018 21:29683576-29683598 GTACACGTGGACATAAAGATGGG + Intronic
1178197411 21:30363357-30363379 GTATACCTGGATATACAGAGTGG + Intronic
1178224891 21:30704811-30704833 GTATATATAGACACAAAGAAGGG - Intergenic
1178463538 21:32825579-32825601 CTATATATAGATGTAAAGAAAGG + Intergenic
1179137239 21:38690561-38690583 GTATACATGGACATAAAGATGGG + Intergenic
1179770143 21:43609232-43609254 GTATACGCGGACATAAAGATGGG + Intronic
1180300801 22:11035102-11035124 ATATACGTGGATATAAACATGGG + Intergenic
1182025914 22:27119139-27119161 GCATATATGGACACAAAGAAGGG + Intergenic
1182960765 22:34472767-34472789 CTATATGTGAATACAAAGATAGG + Intergenic
1184303969 22:43582323-43582345 GTGTATGTGTATAGAAAGGAAGG - Intronic
1184323654 22:43764242-43764264 GTACATGTGGACATAAAGATGGG - Intronic
949376391 3:3394631-3394653 GTATATATGGACACAAAGAAAGG - Intergenic
950970368 3:17180723-17180745 GTATATATGGACATAGAGCATGG + Intronic
951015847 3:17731750-17731772 GTACATGAGGATGTAGAGAATGG + Intronic
951278014 3:20713102-20713124 GTATGTGTGTAGGTAAAGAACGG - Intergenic
951284894 3:20798359-20798381 GTACATGTTGATACAAAGAGGGG - Intergenic
951287389 3:20830968-20830990 GTACATATGGACACAAAGAAGGG - Intergenic
952214751 3:31267055-31267077 CTTCAAGTGGATATAAAGAATGG + Intergenic
952413511 3:33069996-33070018 GTACATATGGACACAAAGAAGGG - Intronic
953109961 3:39925519-39925541 GTATACATGGACATAAAGATGGG - Intronic
953695935 3:45159180-45159202 GTACACGTGGACACAAAGAAGGG - Intergenic
954585215 3:51729140-51729162 GTAAATGTCTATATTAAGAAAGG - Intergenic
955846070 3:63164281-63164303 GTATATGTGAACACAAAGAGGGG + Intergenic
956732401 3:72208582-72208604 GAATTTATGGAAATAAAGAAAGG + Intergenic
957155476 3:76538782-76538804 GTACACATGGACATAAAGAAAGG - Intronic
957380425 3:79421174-79421196 GTACATATGGACACAAAGAAGGG + Intronic
957532303 3:81455962-81455984 GTACACATGGACATAAAGAAGGG + Intergenic
957601900 3:82347211-82347233 TAATATCTGGATATCAAGAAAGG - Intergenic
958076509 3:88688403-88688425 GTACACGTGGACATAAAGACGGG - Intergenic
959030025 3:101288653-101288675 GCATATATGGATATAAACATAGG + Intronic
959217285 3:103467479-103467501 GTAGTTGTTGATGTAAAGAAAGG - Intergenic
959430832 3:106252871-106252893 GTACCTGTGGACACAAAGAAGGG + Intergenic
959451398 3:106507436-106507458 GTACATGTGAACACAAAGAAGGG - Intergenic
959870365 3:111320241-111320263 GTACCTATGGATAAAAAGAAGGG + Intronic
959948910 3:112156362-112156384 GTATGTGTGTATATACACAATGG - Intronic
960015198 3:112879458-112879480 GTACATGTGGACACAAAGAAGGG - Intergenic
960242972 3:115367027-115367049 GTACATGTGGACATAAAGATGGG + Intergenic
960347399 3:116550955-116550977 GTACATATGGACACAAAGAAGGG - Intronic
960930626 3:122845154-122845176 GTACATATGGACACAAAGAAGGG - Intronic
961320756 3:126073064-126073086 GTACACATGCATATAAAGAAGGG + Intronic
961906686 3:130269940-130269962 GTATATGTGGACATACAGAGTGG - Intergenic
963304544 3:143636660-143636682 GTACACGTGGACATAAAGAGTGG - Intronic
963561296 3:146869196-146869218 GTGTATGTAGACATAAAGATGGG - Intergenic
964217856 3:154308022-154308044 GTATATGTGGACATAGAGTGTGG + Intronic
964455875 3:156865561-156865583 GTAGATGTGCAAACAAAGAATGG - Intronic
964511282 3:157454794-157454816 GTACATGTGGACATAAAGATGGG - Intronic
964868434 3:161287501-161287523 GTACATATGGACACAAAGAAGGG + Intergenic
964913470 3:161810895-161810917 GTAAATATGCATATAAATAATGG + Intergenic
964968594 3:162530657-162530679 GTACATATAGACATAAAGAAGGG + Intergenic
965031217 3:163370399-163370421 GTATATATGGACACAAAGAAGGG + Intergenic
965086138 3:164100305-164100327 GAATATATGGATATATAAAAGGG - Intergenic
965087881 3:164122994-164123016 GTACATATGGACACAAAGAAGGG + Intergenic
965117338 3:164507930-164507952 AAATATGAGCATATAAAGAAGGG + Intergenic
965174154 3:165308943-165308965 GTACATATGGACATACAGAATGG + Intergenic
965442180 3:168728385-168728407 GTATATATGAATATATAAAAAGG - Intergenic
965464590 3:169012154-169012176 GTATATGTGGATACAAGGAAGGG - Intergenic
965465509 3:169025220-169025242 TTATATGTGCATATATACAATGG + Intergenic
965877522 3:173345286-173345308 GTACATATGGATACAAAGAAGGG + Intergenic
966344181 3:178960262-178960284 GTATTTGGGGAAAAAAAGAAAGG - Intergenic
967122449 3:186395158-186395180 GTACATATGGACATAAAGATGGG + Intergenic
967451719 3:189631427-189631449 GTATATATAGATATAAAGCCGGG - Exonic
967582284 3:191173154-191173176 GTACACATGGACATAAAGAAGGG - Intergenic
967670788 3:192232740-192232762 GTACATATGGATACAAAGAATGG - Intronic
969160145 4:5249945-5249967 GTGTACATGGATACAAAGAAGGG - Intronic
970171292 4:13293210-13293232 GTACACGTGGACACAAAGAAAGG + Intergenic
970184370 4:13434114-13434136 GTACACATGGACATAAAGAAGGG + Intronic
971288682 4:25314587-25314609 GGAAATGAGGATATAAAGAAAGG - Intronic
971587654 4:28424899-28424921 GTATACAGGGACATAAAGAAGGG + Intergenic
971779898 4:31019751-31019773 GTATATGTGTCTTTAATGAATGG - Intronic
971791134 4:31171114-31171136 ATATGTGTGGAAAGAAAGAATGG + Intergenic
971817832 4:31511731-31511753 GTACACATGGACATAAAGAAAGG - Intergenic
971963174 4:33516333-33516355 GTATAAGAGGGTATAAGGAAGGG - Intergenic
972013873 4:34219657-34219679 GTATATATGTATATATATAATGG - Intergenic
972060345 4:34862191-34862213 ATAAATGTGTATATAAACAATGG + Intergenic
973170565 4:47137866-47137888 ATATATGTATATATAAACAAAGG + Intronic
973255002 4:48101666-48101688 GTGTATGTGTATATAAAGCATGG - Intronic
973287422 4:48434027-48434049 GTACATATGGATAAAAAGATGGG - Intergenic
973767440 4:54176015-54176037 GTAGATATGGACATAAAGATGGG + Intronic
973925670 4:55735159-55735181 GTATATATGAACATAAAGATAGG + Intergenic
973929088 4:55771516-55771538 GTATATGTGGGGAAAAAGGAAGG - Intergenic
974139702 4:57869781-57869803 ATATATGTGCATATATATAAAGG + Intergenic
974159842 4:58124480-58124502 GTACATATGGATACAAAGAAGGG + Intergenic
974455867 4:62128715-62128737 GTATATATGAAGATAAAGACTGG - Intergenic
974676443 4:65095539-65095561 ATATATGTGGATATACATATAGG + Intergenic
974765984 4:66347228-66347250 GTACATATGGACACAAAGAAAGG + Intergenic
975040276 4:69738051-69738073 GTATACGTGGACACAAAGATGGG - Intronic
975286193 4:72623809-72623831 GTATATATGGACACAAAAAAGGG - Intergenic
975390291 4:73808426-73808448 GTATACATGGACACAAAGAAGGG + Intergenic
975452582 4:74546777-74546799 GTAAATGTAAATATAAAGAAGGG - Intergenic
975494383 4:75021650-75021672 GTATACGTAGACACAAAGAAGGG - Intronic
975841807 4:78482075-78482097 GTATGTGTGTTTTTAAAGAAAGG - Intronic
975872582 4:78796895-78796917 GAAAAAGTGGATATAAAGTAGGG + Intronic
975896593 4:79099852-79099874 GTATATATGGACAGAAAGAAGGG - Intergenic
975909623 4:79251427-79251449 GTACATATGGACACAAAGAAGGG + Intronic
975926611 4:79462825-79462847 GGATGTTTGGAGATAAAGAAAGG + Intergenic
976059975 4:81116223-81116245 GTATATATGGACACAAAGAAGGG - Intronic
976136663 4:81945063-81945085 GTATTCGTGGACATAAAGATGGG + Intronic
976452603 4:85208214-85208236 GTACATATGGACACAAAGAAGGG + Intergenic
976503642 4:85820437-85820459 GTACATATGGACACAAAGAAGGG + Intronic
976605245 4:86976568-86976590 GTACATATGGACAGAAAGAAGGG + Intronic
976815575 4:89144684-89144706 GTACATGTGAACACAAAGAAGGG - Intergenic
976940258 4:90691890-90691912 GTACATATGGACACAAAGAAGGG - Intronic
977030716 4:91878969-91878991 GTATATATGGACATAAAGACAGG - Intergenic
977091799 4:92687338-92687360 ATATATGTAGATATATAGATTGG + Intronic
977492222 4:97730192-97730214 GTACAGGTGGACATAAAGATGGG - Intronic
977537180 4:98267532-98267554 GTACATATGGACATAAAGATGGG - Intronic
977543003 4:98340824-98340846 GTACATATGGATACAATGAAGGG + Intronic
977792232 4:101120357-101120379 GAAGATGTAGATATAAACAATGG + Intronic
978054224 4:104243345-104243367 GTATACATGGACATAAAGAAGGG - Intergenic
978154911 4:105478361-105478383 GTACACATGGACATAAAGAAGGG + Intergenic
978240654 4:106512275-106512297 GTACATGTGGACATAAAGATGGG - Intergenic
978402815 4:108349053-108349075 GTATATAGGGACACAAAGAAGGG - Intergenic
978616742 4:110604866-110604888 TTATATGTGTATATATATAAAGG + Intergenic
978676193 4:111319928-111319950 ATATATTTAGATATAAACAAAGG + Intergenic
978731439 4:112031698-112031720 GTATATGTTGATAAAGAAAATGG - Intergenic
978910879 4:114062222-114062244 GTACATATGGACATAAAGATGGG - Intergenic
978990483 4:115075881-115075903 GTGTATGTGTGTGTAAAGAATGG + Intronic
979006602 4:115306189-115306211 GTATATGAGGATTTTGAGAAGGG + Intergenic
979182302 4:117745701-117745723 GTATACATGGACATAAAGATGGG + Intergenic
979182339 4:117746001-117746023 TTCTATGCTGATATAAAGAATGG - Intergenic
979300812 4:119085237-119085259 GTACACGTGGACATAAAGAGTGG + Intergenic
979368659 4:119856559-119856581 GTACATGTGGACACAAAGATGGG + Intergenic
979428753 4:120600827-120600849 GTACACGTGGACACAAAGAAGGG + Intergenic
979636923 4:122966327-122966349 GTATGTGAGGATATAAAGTATGG - Intronic
979709937 4:123767635-123767657 GTACACATGGACATAAAGAAGGG + Intergenic
980207232 4:129735573-129735595 GGATATCTGGAGATAAAGAAAGG + Intergenic
980305558 4:131056263-131056285 GTATATATGGATGTATAGAGTGG - Intergenic
980405259 4:132346342-132346364 GTACATATGGACACAAAGAAGGG + Intergenic
980540188 4:134183409-134183431 GTACATATGGACACAAAGAAGGG + Intergenic
980610353 4:135152405-135152427 ATACATGTGGACATAAAGATGGG - Intergenic
980824689 4:138059362-138059384 GTACATATGGACACAAAGAAGGG - Intergenic
981019899 4:140014858-140014880 TTATATGTGTATAGGAAGAATGG + Intronic
981241314 4:142479762-142479784 GTACACGTGGACACAAAGAAGGG + Intronic
981427240 4:144617621-144617643 ATATATGTAGAAATAAATAAAGG + Intergenic
981621504 4:146705136-146705158 GTACATATGGACATAAAGATGGG - Intergenic
981878302 4:149576341-149576363 GTACACGTGGATACAAGGAAGGG - Intergenic
981914605 4:150020450-150020472 ATAGATTAGGATATAAAGAAAGG - Intergenic
982019153 4:151186343-151186365 GTATAAGTGCCTATAAAGACGGG - Intronic
982231528 4:153212339-153212361 GTATATGTGGACATAGAGAGTGG + Intronic
982764343 4:159326777-159326799 GTAAAAGAGGAAATAAAGAAAGG - Intronic
982976053 4:162062570-162062592 TTCTATATGGATATAAAGTAAGG - Intronic
983268019 4:165528167-165528189 GTACATATGGACACAAAGAAGGG - Intergenic
983307889 4:166017127-166017149 GTATACTTGGACATAAAGACAGG - Intronic
983486717 4:168340836-168340858 GTACATATGGATACAAAAAAGGG - Intergenic
983518499 4:168681420-168681442 GATTATGTGGAAACAAAGAATGG + Intronic
983985537 4:174055386-174055408 GCATACGTGGACACAAAGAAGGG - Intergenic
984305252 4:177981041-177981063 GTATACATGGACACAAAGAAGGG - Intronic
984358561 4:178697598-178697620 GTCTATGTGGATAAACAAAAAGG + Intergenic
984515845 4:180737965-180737987 GTATATGTGCAAATATATAAAGG - Intergenic
984665633 4:182425637-182425659 ATATATTTTGATACAAAGAATGG - Intronic
985027626 4:185754250-185754272 GTACATATGGACACAAAGAAGGG + Intronic
986381015 5:7185791-7185813 GTACACGTGGATGCAAAGAAAGG + Intergenic
986440480 5:7777050-7777072 GTATATATATATATATAGAAGGG - Intronic
986520938 5:8617336-8617358 GTACATATGGACACAAAGAAGGG - Intergenic
986524887 5:8663278-8663300 GGATATGTGGATATATAAAAAGG - Intergenic
986845772 5:11751424-11751446 GTACATGTGGACACAAAGAAGGG - Intronic
986903326 5:12463902-12463924 GTACATGTGGACACAAGGAAAGG + Intergenic
987552994 5:19408203-19408225 GTATATATGGATACAAAGCAGGG - Intergenic
987632508 5:20493426-20493448 CTATTTGTGGAAATAAACAAAGG + Intronic
987747977 5:22001675-22001697 GTACAGGTGGATACAAAGAAAGG - Intronic
988212877 5:28228837-28228859 AGATATATGGATATAAAAAAAGG - Intergenic
988312371 5:29577277-29577299 TTATTTGAAGATATAAAGAATGG - Intergenic
988651570 5:33157627-33157649 GTACACATGGATATAAAGATGGG + Intergenic
989017018 5:36948818-36948840 CTAAATGTGGTTATAAAGTAAGG + Intronic
989505692 5:42224813-42224835 GTACACGTGGACACAAAGAAGGG - Intergenic
989818287 5:45763311-45763333 GTATATGTAGATCTCTAGAAAGG + Intergenic
989840709 5:46064161-46064183 GCATATCTTGAGATAAAGAATGG + Intergenic
990756975 5:59083573-59083595 ATATATGTATATATAAAGATTGG - Intronic
991229386 5:64313346-64313368 GTACATATGGATACAAAGAAGGG - Intronic
991768154 5:70011479-70011501 ATACAGGTGGATACAAAGAAAGG - Intergenic
991847392 5:70886561-70886583 ATACAGGTGGATACAAAGAAAGG - Intergenic
992010500 5:72521324-72521346 GTATTTGTGCATATATAGATAGG + Intergenic
992239389 5:74750767-74750789 ATATATGTGTATATATATAAAGG + Intronic
993209024 5:84923248-84923270 TTATACGTGGTTATAAAGATGGG + Intergenic
993352797 5:86870532-86870554 GTATACATGGACATAAAGATGGG + Intergenic
993830005 5:92743891-92743913 GTATTTGTGAATATAAAGTAAGG - Intergenic
993850613 5:93003245-93003267 GTATATGTTTGCATAAAGAAGGG - Intergenic
994573203 5:101539989-101540011 GTACATATGGACACAAAGAAGGG + Intergenic
994588489 5:101742711-101742733 GTATATGTGGACACAAAGAAGGG - Intergenic
994733953 5:103528900-103528922 GAAGATGTGGGTAAAAAGAATGG + Intergenic
995117499 5:108498473-108498495 GTACACATGGATATAAAGATGGG - Intergenic
995391720 5:111647188-111647210 GTACATGTGGACACAAAGAAGGG - Intergenic
995469287 5:112483628-112483650 GAATATATGGAAATAAGGAAAGG - Intergenic
995488478 5:112663840-112663862 ATATACGTGGACACAAAGAAGGG + Intergenic
996105986 5:119503969-119503991 GTACACGTGGACATAAAGATGGG - Intronic
996138330 5:119873026-119873048 GGAAATATGCATATAAAGAAAGG - Intergenic
996150334 5:120026853-120026875 GTACATATGGACACAAAGAAGGG - Intergenic
996180571 5:120414319-120414341 GTATATATGGACACAAAGAAGGG + Intergenic
996243320 5:121228804-121228826 GTAAACATGGATATAAAGATGGG + Intergenic
996868522 5:128158390-128158412 GTACATATGGATACAAAGAAGGG - Intronic
996870530 5:128187249-128187271 GTATATGTGAATATAGAGCTAGG + Exonic
996897555 5:128503566-128503588 GTATCTGTGCATATCAAGAGTGG - Intronic
997369894 5:133352640-133352662 GTACATGTGGACATAAAGATGGG - Intronic
997820344 5:137060401-137060423 GTATACATGGACACAAAGAAGGG + Intronic
997906205 5:137819730-137819752 GTATATGTAGAATTAGAGAAAGG - Intergenic
999288901 5:150410638-150410660 GTAAATGAGGAAATAAAGAGGGG - Intronic
1000007634 5:157202020-157202042 GCACATATGGGTATAAAGAAGGG - Intronic
1000014330 5:157264643-157264665 GTGTATGTAGATATAAGGAGTGG - Intergenic
1000135249 5:158342173-158342195 GTACATGTGGACACAAAGAAGGG + Intergenic
1002659058 5:180777938-180777960 GTAGATATGGACATACAGAATGG - Intergenic
1002828544 6:796435-796457 GTGTATGTGGTTATAAACATAGG - Intergenic
1002870130 6:1159517-1159539 GTACATATGGATGCAAAGAAGGG - Intergenic
1003626130 6:7743172-7743194 ATATATGTAGATATAGAGGAAGG + Intronic
1004153780 6:13148570-13148592 GTATATGTGAAAAAAAAGGAAGG - Intronic
1004209449 6:13623858-13623880 GTATATGTGTCTATAGATAATGG + Intronic
1004608451 6:17215793-17215815 GTACATGTGGGCATAAAGATGGG - Intergenic
1004611995 6:17250825-17250847 GTATACGTGCACATAAAGATGGG - Intergenic
1004641018 6:17515409-17515431 GTACACGTGGACATAAAGACGGG + Intronic
1004745494 6:18504890-18504912 CTAATTGTGGATATTAAGAATGG - Intergenic
1005159449 6:22842241-22842263 GTACATGTGAATATACAGAGTGG + Intergenic
1007354434 6:41302262-41302284 GTACATATGGACACAAAGAAGGG + Intergenic
1007993280 6:46279663-46279685 ATATATGTGGCTATAAACATTGG + Intronic
1008020703 6:46574667-46574689 GTATCTATGGAGAGAAAGAAAGG - Intronic
1008213686 6:48758361-48758383 GTATACATGGACATAAAGATGGG + Intergenic
1008229595 6:48968817-48968839 ATATATGAGGAAATAAAGAAAGG - Intergenic
1008237572 6:49068915-49068937 GTATATGTGCATATACATATGGG + Intergenic
1008269942 6:49479919-49479941 ATATATATGGACACAAAGAAGGG + Intronic
1008285463 6:49643901-49643923 GTACACCTGGATACAAAGAAGGG - Intergenic
1008407917 6:51139888-51139910 GCATATGTGGATACAAATCAAGG + Intergenic
1008523693 6:52386622-52386644 GTATACATGGACATAGAGAAGGG + Intronic
1008866057 6:56211237-56211259 GTATATGTATATATAATGAAAGG + Intronic
1008912857 6:56755452-56755474 GTATATGTGAATGTAAAGTGGGG - Intronic
1009161998 6:60294531-60294553 GTATATATATATATAAAGTAAGG - Intergenic
1009195360 6:60678275-60678297 GTACATGTGGACATAAAGATGGG + Intergenic
1009505174 6:64468693-64468715 GTACATTTGGACACAAAGAAAGG - Intronic
1010023270 6:71186453-71186475 GTATATGTGGACACAAAGAAGGG + Intergenic
1010358130 6:74959677-74959699 GTAAATATTGAGATAAAGAAGGG - Intergenic
1010442954 6:75919307-75919329 GTAGATATGGACATAAAGAGTGG - Intronic
1010626669 6:78144715-78144737 GTATATGTGGCTATTATAAATGG - Intergenic
1010748421 6:79590620-79590642 GTATATACGGATATAAAGAAGGG + Intergenic
1011251841 6:85380046-85380068 TTATATCTGGATATAAAAACTGG - Intergenic
1011297023 6:85837407-85837429 GTATATATGGACACAAAGAAGGG + Intergenic
1011633223 6:89347226-89347248 GTTTATGTGGCTTTAAAGCAGGG - Intronic
1012396093 6:98799088-98799110 GTACATATGGACGTAAAGAAGGG + Intergenic
1012440695 6:99259783-99259805 GTACATATGGACACAAAGAAGGG + Intergenic
1012509462 6:99986622-99986644 GTACATGTGGACATACAGAGAGG + Intronic
1012555072 6:100501660-100501682 GATTATTTGGATATAAAAAATGG + Intergenic
1012991816 6:105933865-105933887 GTACACATGGATACAAAGAAGGG - Intergenic
1013338873 6:109193167-109193189 GTACATATGGACATAAAGATGGG - Intergenic
1013441292 6:110172734-110172756 GTATACATGGACATAAAGAGTGG + Intronic
1013727612 6:113119029-113119051 GTATACATGGACACAAAGAAAGG + Intergenic
1013885680 6:114963152-114963174 CTACATATGGACATAAAGAAGGG - Intergenic
1013944048 6:115701817-115701839 GTATATGTGGATATAGAGGGTGG - Intergenic
1014264731 6:119263454-119263476 GTACATATGGACACAAAGAAAGG + Intronic
1014274166 6:119368067-119368089 GTATACATGGATATAAAGATAGG + Intergenic
1014306267 6:119746673-119746695 GTACATGTGAACATAAAGATGGG - Intergenic
1014376883 6:120687151-120687173 GTATACATGGACACAAAGAAGGG + Intergenic
1014481352 6:121941458-121941480 GTACATATGGATACAAAGAAGGG - Intergenic
1014782058 6:125575694-125575716 GTACATGTGGAGATAAAGATGGG - Intergenic
1015931109 6:138360571-138360593 GTACATATGGACACAAAGAAGGG - Intergenic
1016088935 6:139951527-139951549 GTACATATGGATACAAAGAAAGG + Intergenic
1016166400 6:140950196-140950218 GGATAAAAGGATATAAAGAAAGG + Intergenic
1016227835 6:141762023-141762045 GAATATATGGATATAAAGATGGG + Intergenic
1016372229 6:143386984-143387006 GTACACATGGACATAAAGAAGGG - Intergenic
1016789724 6:148055398-148055420 ATTTATGTGGACATAAAAAATGG - Intergenic
1016998940 6:149982155-149982177 ATATATATGAATATAAAGATGGG + Intergenic
1017305093 6:152908877-152908899 GTACATATGGACACAAAGAAGGG - Intergenic
1017929866 6:158942403-158942425 GTAAACATGGATACAAAGAAGGG - Intergenic
1018759608 6:166880883-166880905 GTACATATGGACACAAAGAAGGG + Intronic
1019077758 6:169403606-169403628 GTACATGTGGATATGAGGATGGG - Intergenic
1019230407 6:170555884-170555906 GCAGATGAGGATATAAAGATAGG - Intronic
1020362012 7:7336842-7336864 GTACATATGGACATAAAGATGGG - Intergenic
1020545245 7:9520247-9520269 GTACATATGGACACAAAGAAGGG + Intergenic
1020628512 7:10612187-10612209 GGGAATATGGATATAAAGAAAGG - Intergenic
1020742148 7:12034484-12034506 GTACACGTGGATATACAGATTGG + Intergenic
1020820954 7:12966777-12966799 GTATAGCTTGATATAAAAAATGG + Intergenic
1020838018 7:13178921-13178943 ATATATGTGTATATAAAATATGG - Intergenic
1021413823 7:20358900-20358922 GTACATGTGGACATAAACATGGG - Intronic
1021419433 7:20428857-20428879 GTATATATGGATACAAAAAGAGG + Intergenic
1021536384 7:21709375-21709397 GTACATGTGGACATAAAGATGGG + Intronic
1021750228 7:23791425-23791447 GTACATATGGACACAAAGAAGGG + Intronic
1022556767 7:31305988-31306010 GCATATGTATATATAAAGAAAGG + Intergenic
1023346550 7:39277442-39277464 GTACACGTGGACATAAAGATGGG - Intronic
1023442468 7:40198525-40198547 GTTTGTGTGCATATAAAGCAAGG + Intronic
1023657683 7:42441486-42441508 GTACATATGGACACAAAGAAGGG - Intergenic
1023900372 7:44472679-44472701 GTATTTGTAGATACAAAGAATGG + Intronic
1024076701 7:45824496-45824518 GTACATATGGACATAAAGATGGG + Intergenic
1024819411 7:53309996-53310018 GAAAATATGCATATAAAGAAAGG + Intergenic
1024847169 7:53659993-53660015 TTATATGTGGAAGTAAAGAATGG + Intergenic
1024890677 7:54198176-54198198 GTACATATGGACATAAAGATGGG - Intergenic
1024927281 7:54630507-54630529 GTACATATGGACACAAAGAAGGG - Intergenic
1024929515 7:54655427-54655449 GTATCTGTGGCTATAAATAAGGG - Intergenic
1025059495 7:55792525-55792547 GTACATATGGACATAAAGATGGG - Intergenic
1025086879 7:56030578-56030600 GTACATGAGGATACAAAGACGGG + Intronic
1025127716 7:56356929-56356951 GTACATATGGACATAAAGACGGG - Intergenic
1025615177 7:63112173-63112195 GTACATATGGACATAAAGATGGG - Intergenic
1026193544 7:68151525-68151547 GTACACGTGGACACAAAGAAGGG + Intergenic
1026522334 7:71128376-71128398 GTATGTGTGGACATCAAGATGGG + Intergenic
1026674585 7:72418155-72418177 GTACATGTGGACATCAAGATGGG - Intronic
1027340964 7:77208467-77208489 GTATTTGTGTATCTAAAAAAAGG + Intronic
1027481601 7:78704955-78704977 GTACATGTGGACAGAAAGAAGGG + Intronic
1027495676 7:78885107-78885129 GTACATATGGATATAAAGATAGG + Intronic
1027506742 7:79025302-79025324 GAGTATGTGGACACAAAGAAGGG + Intronic
1027634304 7:80651188-80651210 ATACACGTGGATATAAAGAAGGG + Intronic
1027812498 7:82922540-82922562 GTACACATGGATACAAAGAAGGG + Intronic
1028336535 7:89664126-89664148 GTAAATGAGGATAGAAAGACGGG + Intergenic
1028430625 7:90743839-90743861 GTAAATCTGAAAATAAAGAAGGG - Intronic
1028642720 7:93061374-93061396 GTAAACATGGACATAAAGAAAGG + Intergenic
1028758391 7:94464763-94464785 GTACACGTAGACATAAAGAAGGG - Intergenic
1029594442 7:101529614-101529636 GTATATATGGACATAAAGATGGG - Intronic
1029806433 7:103001947-103001969 GGATATATGGATATATAAAAGGG - Intronic
1029808714 7:103023927-103023949 GTACATATGGACACAAAGAAAGG + Intronic
1030732430 7:113005975-113005997 GTACATATGGACACAAAGAAGGG + Intergenic
1030733787 7:113019701-113019723 GTACATATAGACATAAAGAAGGG - Intergenic
1030790970 7:113728361-113728383 ATTTATGTGGATATAACTAAGGG - Intergenic
1030989067 7:116278432-116278454 GTACATATGGACACAAAGAAGGG + Intergenic
1031258227 7:119483426-119483448 GTACATATGGAAACAAAGAAGGG - Intergenic
1031318979 7:120297248-120297270 GTACATGTGGACATAGAGAGTGG - Intronic
1031542618 7:123013370-123013392 GTACATATGGACACAAAGAAGGG - Intergenic
1031547000 7:123063170-123063192 GTACACATGGATACAAAGAAGGG - Intergenic
1031571746 7:123367949-123367971 GTACATATGGACATAAAGATGGG - Intergenic
1031572419 7:123375756-123375778 GTACATATGGACATAAAGATGGG + Intergenic
1032616534 7:133478492-133478514 GTATCTCTGGATATAAACTAAGG + Intronic
1032625017 7:133582165-133582187 GTACATGTGGACAAAAAGAAGGG - Intronic
1032715260 7:134503842-134503864 GAATATTTGGATAAAAATAAAGG - Intergenic
1032914480 7:136473951-136473973 GTCTATATGGACACAAAGAAGGG - Intergenic
1033583335 7:142755865-142755887 GTACACATGGATATAAAGATGGG - Intronic
1033586346 7:142777373-142777395 GTACACATGGATATAAAGATGGG - Intergenic
1033592805 7:142827490-142827512 GCATACATGGATATAAACAATGG + Intergenic
1033604031 7:142912313-142912335 GTACATGTGGATAAATGGAAGGG - Intronic
1033620252 7:143056088-143056110 GTATACATGGACACAAAGAAGGG + Intergenic
1033725471 7:144111471-144111493 GTACATATGGACATAAAGATGGG - Intergenic
1033985869 7:147224771-147224793 GTATATGTGTATATATAGAGAGG - Intronic
1034173732 7:149083732-149083754 GTATATATGGATACGAAGCAGGG - Intronic
1036464196 8:8981085-8981107 GTATATCTGAATATTAAAAAAGG + Intergenic
1036686104 8:10911821-10911843 GAGTATGTGTATATATAGAAAGG + Intronic
1036778609 8:11630464-11630486 GTACACGTGGACATAAAGATGGG - Intergenic
1036920563 8:12850428-12850450 GTATATGTGTATTGGAAGAAAGG + Intergenic
1036969480 8:13339022-13339044 GTATATCTGGTAATAAGGAAAGG + Intronic
1037222111 8:16536541-16536563 TTATACGTGGATATAAATATGGG + Intronic
1037349434 8:17934874-17934896 GTACATGTGAAAATCAAGAAAGG - Intronic
1037461096 8:19110146-19110168 GTATTTGTAGAAATAAAGAATGG - Intergenic
1037551387 8:19975039-19975061 AGATACCTGGATATAAAGAAGGG + Intergenic
1038071512 8:24019353-24019375 GTATATGGGGATAAAAATGAAGG + Intergenic
1038322350 8:26539029-26539051 GTACAAGTGGACATAAAGATGGG - Intronic
1038750435 8:30290046-30290068 GTATACGCGGACACAAAGAAGGG - Intergenic
1038864076 8:31420269-31420291 GAATATATGGATATATACAAAGG - Intergenic
1038886755 8:31670995-31671017 GTACACTTGGATATAAAGATGGG - Intronic
1038985006 8:32799027-32799049 GTACACGTGGACACAAAGAAGGG + Intergenic
1040387892 8:46925934-46925956 ATATATGTGGATATATGAAAGGG + Intergenic
1040812264 8:51467420-51467442 GTACATATGGACATAAAGATGGG + Intronic
1041075786 8:54168532-54168554 GTACATGTGGACACAAAGAAGGG + Intergenic
1041081729 8:54221004-54221026 TTTTATGTGAATATAAAGATAGG - Intergenic
1041599079 8:59694330-59694352 TTATATGTGGATTTAAACATTGG - Intergenic
1041766902 8:61428339-61428361 GTATGTGTGTGTGTAAAGAAAGG + Intronic
1042460549 8:69060435-69060457 GTATACATGGATATAAAGATGGG - Intergenic
1042703568 8:71643302-71643324 GGATATGTGGATATTAACTATGG + Intergenic
1042868269 8:73374841-73374863 GTACACATGGATATAAAGATGGG + Intergenic
1042963667 8:74328821-74328843 GTCTATGGGGATCTAAAGCAAGG + Intronic
1043269311 8:78309869-78309891 GTACATGTAGATATAGAGAGTGG - Intergenic
1043638133 8:82412475-82412497 GTAAATGAGGTCATAAAGAAGGG + Intergenic
1043654193 8:82641212-82641234 GTACATGTGGATTTACATAATGG + Intergenic
1043677717 8:82979672-82979694 GTATGTGTAGAAAGAAAGAATGG + Intergenic
1043778206 8:84297244-84297266 GTACATATGGATACAAAGAAGGG - Intronic
1043821334 8:84869013-84869035 TTATATATATATATAAAGAAAGG + Intronic
1044296961 8:90539517-90539539 GTAAATGTGGATAAACAGGAAGG - Intergenic
1044574366 8:93752237-93752259 GTACAGGTGGACACAAAGAAGGG + Intergenic
1044596405 8:93962916-93962938 GTATACATGGATATAAGGATGGG - Intergenic
1044803425 8:95980314-95980336 GTACATATGGACACAAAGAAGGG - Intergenic
1045274718 8:100692680-100692702 GTATAAGTTGGTATAAGGAAGGG - Intronic
1045658597 8:104412375-104412397 GAAAATGTGGCTATAAAGAGAGG + Intronic
1045691745 8:104766427-104766449 GTACATATGGACAAAAAGAAGGG + Intronic
1045739882 8:105344652-105344674 GTATATATAGATATAAATGAAGG - Intronic
1045909229 8:107386194-107386216 GTACATGTGGACAAAAAGAAGGG + Intronic
1046002170 8:108434260-108434282 GTATATGTGGTAATAAAAATGGG + Intronic
1046113502 8:109755721-109755743 GTACACGTGGACACAAAGAAGGG - Intergenic
1046346976 8:112942663-112942685 GTACACGTGGACACAAAGAAGGG + Intronic
1046685696 8:117224360-117224382 GTATGTGTGTATGTAAAAAATGG + Intergenic
1046865351 8:119143402-119143424 GTACACATGGATATAAAGAAAGG + Intergenic
1046975468 8:120271176-120271198 GTACATGTAGACACAAAGAAGGG + Intronic
1046979737 8:120324023-120324045 GTACATGTGGACACAAAGGAGGG + Intronic
1047159109 8:122356583-122356605 GTACACGTGGATGCAAAGAAGGG - Intergenic
1047371448 8:124259281-124259303 GTACACATGGATATAAAGATGGG - Intergenic
1047609527 8:126507589-126507611 GTATATATGGACACAAAGAAGGG + Intergenic
1048183138 8:132214566-132214588 GTATTTGTGCATATGGAGAAGGG - Intronic
1048679666 8:136825967-136825989 GTAAGTGTGGACACAAAGAAGGG + Intergenic
1048780409 8:137992856-137992878 GTACACATGGACATAAAGAAGGG - Intergenic
1050111360 9:2219917-2219939 GTATATATGGACACAAAGAAGGG - Intergenic
1050835835 9:10077684-10077706 GTACATATGGACACAAAGAAGGG - Intronic
1050871709 9:10579307-10579329 GTATACCTGGACATAAAGATGGG - Intronic
1050933473 9:11361668-11361690 GTATATATGAACACAAAGAAAGG + Intergenic
1051513433 9:17905405-17905427 GAATATGTGGATTGAATGAATGG + Intergenic
1051551883 9:18338813-18338835 GTACATATGGACACAAAGAAGGG - Intergenic
1051729091 9:20120502-20120524 GTATACATGGACACAAAGAAGGG + Intergenic
1051833083 9:21302683-21302705 GTATATATGGACACAAAAAAAGG + Intergenic
1051933303 9:22412877-22412899 GAACATATGGATATAAAGATGGG + Intergenic
1053491773 9:38512085-38512107 GTATTTTTAGAAATAAAGAATGG + Intergenic
1053570258 9:39297077-39297099 GTACATATGGACACAAAGAAGGG + Intergenic
1053836212 9:42138032-42138054 GTACATATGGACACAAAGAAGGG + Intergenic
1054091880 9:60856087-60856109 GTACATATGGACACAAAGAAGGG + Intergenic
1054113294 9:61131677-61131699 GTACATATGGACACAAAGAAGGG + Intergenic
1054126891 9:61321929-61321951 GTACATATGGACACAAAGAAGGG - Intergenic
1054594406 9:67050492-67050514 GTACATATGGACACAAAGAAGGG - Intergenic
1054958558 9:70941544-70941566 GTATATGTATATATGAAGAGGGG - Intronic
1055365226 9:75536747-75536769 GTATACATGGACACAAAGAAAGG - Intergenic
1055534002 9:77217500-77217522 GTATATATGGACATAGAGCATGG - Intronic
1056443002 9:86638968-86638990 AAATATGTGGGGATAAAGAAGGG + Intergenic
1056785066 9:89586102-89586124 GTACCTGTGGACATAAAGATGGG + Intergenic
1057029429 9:91763125-91763147 GTACACATGGACATAAAGAAGGG + Intronic
1057408030 9:94791292-94791314 GTACACATGGATACAAAGAAGGG + Intronic
1057452882 9:95181119-95181141 GTGTATGTGTATATATAGAGAGG - Intronic
1058405289 9:104666739-104666761 GTATACATGGACATAAAGATGGG + Intergenic
1059267411 9:113048567-113048589 GGATATGTGGCTATATGGAAGGG + Intronic
1059493413 9:114688911-114688933 GTGTACATGGACATAAAGAAGGG - Intergenic
1059512034 9:114857631-114857653 ATATACGTGGACATAAAGAAGGG + Intergenic
1059622597 9:116024052-116024074 GTAGCTGTGGACACAAAGAAGGG - Intergenic
1059633074 9:116145647-116145669 GTACATGTGAACACAAAGAAAGG + Intergenic
1059709800 9:116857011-116857033 GGATATGTGGAGAAAAATAATGG - Intronic
1059785868 9:117583477-117583499 GTACACATGGACATAAAGAAGGG - Intergenic
1059920517 9:119155337-119155359 GTACATATGAATATACAGAAAGG + Intronic
1060122022 9:121000869-121000891 GTATATATGGACACAAAGAAGGG - Intronic
1060239663 9:121892129-121892151 GTATGTGTGTATATATATAAAGG - Intronic
1060316282 9:122514315-122514337 GTACACGTGGACATAAAGATGGG - Intergenic
1060922382 9:127430458-127430480 GTATATATGGACACAAAGATGGG - Intronic
1185648057 X:1629075-1629097 ATATATATATATATAAAGAAAGG - Intronic
1185730167 X:2455248-2455270 GTACCCGTGGATATAAAGAAGGG + Intronic
1185732429 X:2472282-2472304 GCACTGGTGGATATAAAGAAGGG + Intronic
1185833030 X:3319622-3319644 GTACATATGGACATAAAGATAGG + Intronic
1185918871 X:4066880-4066902 GTACACGTGGACACAAAGAAGGG + Intergenic
1186019720 X:5240346-5240368 GTACATGTGGACATAAAGATGGG - Intergenic
1186248816 X:7644328-7644350 GTATACATGGACATAAAGATGGG + Intergenic
1186632388 X:11364155-11364177 GTACACATGGATACAAAGAAGGG + Intronic
1186947391 X:14584002-14584024 ATATATATGGACACAAAGAAGGG + Intronic
1187054300 X:15727379-15727401 GTACATATGGACACAAAGAAGGG - Intronic
1187214494 X:17263546-17263568 GTACATGTGGACACAAAGAAGGG + Intergenic
1187217819 X:17294210-17294232 GTACCTGTGGACACAAAGAAGGG + Intergenic
1187505103 X:19873031-19873053 GCATCTATGGAGATAAAGAATGG + Intronic
1188094604 X:26005753-26005775 GTATATGTGGTAACAAAAAAAGG + Intergenic
1188163707 X:26834691-26834713 GGATATATGTATATATAGAAGGG - Intergenic
1188177734 X:27013867-27013889 GTACATGTGGACTTAAAGATGGG - Intergenic
1188356885 X:29202811-29202833 GTACATGTGGAAAGAAAGAAGGG + Intronic
1188378648 X:29464882-29464904 GGACATATGGATAAAAAGAAGGG + Intronic
1188826272 X:34839245-34839267 GTATATATAGACACAAAGAAGGG - Intergenic
1190489046 X:50962848-50962870 GTACATATGGACACAAAGAAAGG + Intergenic
1190566883 X:51739517-51739539 TTATATATATATATAAAGAAAGG - Intergenic
1190812188 X:53895583-53895605 GTACACATGGATACAAAGAAGGG + Intergenic
1190996312 X:55613383-55613405 ATATATGTGGATATATATAAAGG + Intergenic
1190996329 X:55613628-55613650 ATATATATGGATATATATAAAGG + Intergenic
1191031174 X:55974137-55974159 GTACACATGGATAAAAAGAAGGG + Intergenic
1191651832 X:63547291-63547313 GTAGATATGGACACAAAGAAGGG + Intergenic
1191961590 X:66708680-66708702 GTATGTATGTATATAAAGAAAGG - Intergenic
1192075793 X:67994759-67994781 GTACATATGGACACAAAGAAGGG - Intergenic
1192288843 X:69769764-69769786 GAAAATATGGATATATAGAAAGG - Intronic
1192759576 X:74082335-74082357 GTACATGTGGACATACAGAGTGG - Intergenic
1193035255 X:76943188-76943210 GTACATATGGACACAAAGAAAGG - Intergenic
1193054112 X:77131747-77131769 GTACATATGGAAACAAAGAAGGG + Intergenic
1193165877 X:78279898-78279920 GTATATATGGACATAAAGATGGG + Intronic
1193229396 X:79026298-79026320 GTACATGTGGACACAAAGAATGG + Intergenic
1193674356 X:84431057-84431079 GTACATATGGACAAAAAGAAGGG - Intronic
1193823189 X:86191429-86191451 GTATATATAGACACAAAGAAGGG + Intronic
1193851731 X:86545354-86545376 GTATATATGGACACAAAGAAGGG + Intronic
1193864734 X:86717479-86717501 GTATATGTAGATAGATAGATAGG + Intronic
1193898836 X:87149956-87149978 GTACATTAGGATATAAAGAAGGG - Intergenic
1193970765 X:88049037-88049059 GCATATACGGATGTAAAGAAGGG - Intergenic
1194010540 X:88555048-88555070 GTATATGTCAACATAAAGACGGG - Intergenic
1194010663 X:88557127-88557149 ATATATTTTGATATAAAAAATGG + Intergenic
1194085218 X:89518556-89518578 GTACATGTGAACATAAAGAAGGG - Intergenic
1194129827 X:90067695-90067717 GTACATATGGACACAAAGAAGGG - Intergenic
1194216905 X:91141510-91141532 GTACACGTGGACACAAAGAAGGG - Intergenic
1194319104 X:92421300-92421322 GTACATATGGACACAAAGAAAGG - Intronic
1194776057 X:97966252-97966274 ATATACGTGGATATAAAAAATGG - Intergenic
1194873194 X:99158641-99158663 GTATACATGGATATAAAGAGGGG + Intergenic
1195124858 X:101798224-101798246 GTACATATGGATATAAAGAAAGG + Intergenic
1195179877 X:102347399-102347421 GTACATACGGATAGAAAGAAAGG - Intergenic
1195576342 X:106455669-106455691 GCACATGTGGACACAAAGAAGGG + Intergenic
1196010561 X:110883021-110883043 GTACACATGGATACAAAGAAGGG - Intergenic
1196044076 X:111238077-111238099 GTACACATGGACATAAAGAAGGG - Intergenic
1196064286 X:111445615-111445637 GTACATATGGACATAAAGACGGG - Intergenic
1196244580 X:113385589-113385611 GTACACATGGATACAAAGAAGGG - Intergenic
1196502116 X:116396790-116396812 GTAAATGTGGACATGAAGATGGG - Intergenic
1196760360 X:119195529-119195551 GTACACATGGATATAAAGATGGG + Intergenic
1197013843 X:121599984-121600006 GTACACATGGACATAAAGAAGGG - Intergenic
1197015752 X:121624414-121624436 GTTTATCTGGCTAGAAAGAAAGG + Intergenic
1197115385 X:122826376-122826398 GTACATATGGACATAAATAAGGG - Intergenic
1197598891 X:128503706-128503728 GTAAATATGGAAACAAAGAAGGG - Intergenic
1198225221 X:134638974-134638996 GTACACATGGACATAAAGAAGGG - Intronic
1198274433 X:135087865-135087887 GTATATGTGGGGGGAAAGAAGGG + Intergenic
1198494326 X:137175894-137175916 GTGCATGTGGATACAAAAAAGGG - Intergenic
1198578041 X:138032457-138032479 GTATATGTAGACATGAAGATAGG + Intergenic
1198855022 X:141006457-141006479 GTATACATGGACACAAAGAAGGG + Intergenic
1198907670 X:141580912-141580934 GTATACATGGACACAAAGAAGGG - Intergenic
1198909121 X:141593512-141593534 GTATACATGGACACAAAGAAGGG + Intronic
1199217018 X:145271577-145271599 GTATGTATGGACACAAAGAAAGG + Intergenic
1199290124 X:146095827-146095849 GTACATGTAGACACAAAGAAGGG + Intergenic
1199433579 X:147787624-147787646 AAATATGTGCATTTAAAGAAAGG - Intergenic
1199636361 X:149816407-149816429 GCATATGTGGACACAAAGGAGGG + Intergenic
1199706614 X:150431605-150431627 GTACATATGGACATAAAGAGGGG - Intronic
1199757467 X:150878663-150878685 GTATATGTGAATAAAATGCATGG + Intronic
1200437864 Y:3174438-3174460 GTACATGTGAACATAAAGAAGGG - Intergenic
1201254119 Y:12090246-12090268 TTATATGTGGATGAAAAGAATGG - Intergenic
1201484175 Y:14474648-14474670 GCAGATATGGATATAAAGATGGG - Intergenic
1201690430 Y:16758440-16758462 ATATATGTAGATATCCAGAAGGG - Intergenic
1201983608 Y:19935906-19935928 GTACATGTGAATATAAAGAAAGG + Intergenic