ID: 909741722

View in Genome Browser
Species Human (GRCh38)
Location 1:79037443-79037465
Sequence CTGTGTGCCTAGAAGAGCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909741719_909741722 8 Left 909741719 1:79037412-79037434 CCCAGAATGGTAGATCCACTGAG 0: 22
1: 926
2: 1240
3: 1723
4: 2177
Right 909741722 1:79037443-79037465 CTGTGTGCCTAGAAGAGCTATGG No data
909741717_909741722 14 Left 909741717 1:79037406-79037428 CCAGACCCCAGAATGGTAGATCC 0: 1268
1: 1929
2: 1766
3: 1012
4: 639
Right 909741722 1:79037443-79037465 CTGTGTGCCTAGAAGAGCTATGG No data
909741714_909741722 21 Left 909741714 1:79037399-79037421 CCATCCTCCAGACCCCAGAATGG 0: 840
1: 1321
2: 1065
3: 761
4: 712
Right 909741722 1:79037443-79037465 CTGTGTGCCTAGAAGAGCTATGG No data
909741718_909741722 9 Left 909741718 1:79037411-79037433 CCCCAGAATGGTAGATCCACTGA 0: 788
1: 1110
2: 1492
3: 1250
4: 917
Right 909741722 1:79037443-79037465 CTGTGTGCCTAGAAGAGCTATGG No data
909741721_909741722 -7 Left 909741721 1:79037427-79037449 CCACTGAGAGTTTGCACTGTGTG No data
Right 909741722 1:79037443-79037465 CTGTGTGCCTAGAAGAGCTATGG No data
909741720_909741722 7 Left 909741720 1:79037413-79037435 CCAGAATGGTAGATCCACTGAGA 0: 26
1: 949
2: 1296
3: 1701
4: 1507
Right 909741722 1:79037443-79037465 CTGTGTGCCTAGAAGAGCTATGG No data
909741716_909741722 17 Left 909741716 1:79037403-79037425 CCTCCAGACCCCAGAATGGTAGA 0: 1319
1: 1995
2: 1612
3: 1012
4: 675
Right 909741722 1:79037443-79037465 CTGTGTGCCTAGAAGAGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909741722 Original CRISPR CTGTGTGCCTAGAAGAGCTA TGG Intergenic
No off target data available for this crispr