ID: 909741843

View in Genome Browser
Species Human (GRCh38)
Location 1:79038628-79038650
Sequence CCTACCCAGCCCAAGTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909741843_909741848 -6 Left 909741843 1:79038628-79038650 CCTTCCAACTTGGGCTGGGTAGG No data
Right 909741848 1:79038645-79038667 GGTAGGGTTGGTTTCTGCTTTGG No data
909741843_909741850 12 Left 909741843 1:79038628-79038650 CCTTCCAACTTGGGCTGGGTAGG No data
Right 909741850 1:79038663-79038685 TTTGGGAAACTTCTATGTCCTGG No data
909741843_909741849 -5 Left 909741843 1:79038628-79038650 CCTTCCAACTTGGGCTGGGTAGG No data
Right 909741849 1:79038646-79038668 GTAGGGTTGGTTTCTGCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909741843 Original CRISPR CCTACCCAGCCCAAGTTGGA AGG (reversed) Intergenic
No off target data available for this crispr