ID: 909742376

View in Genome Browser
Species Human (GRCh38)
Location 1:79045833-79045855
Sequence TCCTTATGATACGGGAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909742376_909742379 21 Left 909742376 1:79045833-79045855 CCAGCACTCCCGTATCATAAGGA No data
Right 909742379 1:79045877-79045899 CTTGAAATTAAAAAATAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909742376 Original CRISPR TCCTTATGATACGGGAGTGC TGG (reversed) Intergenic
No off target data available for this crispr