ID: 909743961

View in Genome Browser
Species Human (GRCh38)
Location 1:79069257-79069279
Sequence AAGCTGAGCCAATTCCAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909743959_909743961 14 Left 909743959 1:79069220-79069242 CCTAATTTGCACAGAGGCATAAA No data
Right 909743961 1:79069257-79069279 AAGCTGAGCCAATTCCAAATAGG No data
909743960_909743961 -9 Left 909743960 1:79069243-79069265 CCTGCAGTTTCAAAAAGCTGAGC No data
Right 909743961 1:79069257-79069279 AAGCTGAGCCAATTCCAAATAGG No data
909743958_909743961 15 Left 909743958 1:79069219-79069241 CCCTAATTTGCACAGAGGCATAA No data
Right 909743961 1:79069257-79069279 AAGCTGAGCCAATTCCAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909743961 Original CRISPR AAGCTGAGCCAATTCCAAAT AGG Intergenic
No off target data available for this crispr